Transcript asmbl_26151

Sequence
Transcript Sequence for observation asmbl_26151 of TGE0032880:
AAGGTTTAGCGAGGTAGGTCCGGGTCCCGGAGGCTCCACCCTGAACTATATGGGCGATGAACCCTTGTGCAGTTACCTGCAGGCGCAGCGGGAAGCCACGCGTGCCCACGCCCCGCACATGGGAGCTTAGGAGATTGTGGGTGAGCAGTTTCATGTTGTCACAGCGGAGCGCGTGAGGCCGGAACCGGAAGGAGTCCACACTTCTCCTTTCTACCACTTCCGCTTTGAAGCCGTTGAACTCTTCGCCGGACCGGAAGTGGCCGACTTAGGGGACCTTTTGGGGGGCTTGGCGGCAGCCGAGATCGGAAGGACTGTGTTGGGTCACGTCCTGGTACCGGAAGCGTTTCTCGGGGAGACTGCAAAGGCTTACGCCGAATCCCGCTCGCTGAAGAGAGTACACACTATGCAAGTCACGTGTAAACCGGCTGCGTTACGGCGCAGGTAAAACGAACACATTTGAGGCTCAGCCAGATCATCCCCGACCTCTGTTTGCGGCTATGGGTCACGAACTGTCACGTCGGTAAACCAGGCACCTCTTTCTGCGATTGAAGAAGGTGTGCGAGCCCTGAGAGCCCCGCCGCGTCGTAGTGCGTCACGGCCCTGCCCCTCTAAGCCGGCGCTGTGGCTGCGACGTGGGACGTGCGGCGTGGGCGGAGCTGTCCCTGCATCCACCTCCTGTGGGCAGAGCCATCTGCGGGTGGGCTGCGGCAGCGGGGCGGGTATGCTACAGCTGGGGCTTCGAGTCCTGGGCTGCAAAGCCAGTTCTGTGCTCCGTGCATCGACGTGCTTGGCAGGCAGAGCAGGCCGGAAAGAAGCAGGTTGGGAGTGTGGCGGAGCCCGCAGCTTCAGCAGCTCCGCGGTGACCATGGCCCCGATCAAGGTGGGAGATGCCATTCCCTCAGTGGAGGTATTTGAAGGGGAACCGGGAAAGAAGGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAAGGTGTTTTGTTTGGAGTCCCTGGGGCATTTACACCTGGCTGTTCTAAGACCCACCTGCCTGGGTTTGTGGAGCAAGCTGGAGCTCTGAAGGCCAAGGGAGCGCAGGTGGTGGCCTGTCTGAGCGTTAATGACGTCTTTGTGATTGAAGAGTGGGGTCGAGCCCACCAGGCAGAAGGCAAGGTTCGGCTCCTGGCTGACCCCACTGGAGCCTTTGGGAAGGCGACAGACTTATTATTGGATGATTCTTTGGTGTCTCTCTTTGGGAATCGTCGGCTGAAAAGGTTCTCCATGGTGATAGACAACGGCATAGTGAAGGCACTGAACGTGGAGCCAGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCTCAACTCTGAGGCCCTGGCCAGATGTCCTCTGACTCTCCCATCTCTCCCACCCGGCTCTAGGCCAAAAGGCTCGGTACCTCCTTACTGGGAGCCACGTAAATGGAACCTTGACCATATTTCTGCAATAAACAGTTTAATTTGTG