Transcript asmbl_30805

Sequence
Transcript Sequence for observation asmbl_30805 of TGE0002767:
CAGGAGAAGAAACTAAGACCTGGAGTTTGAGTAATTCTTTCAAAGCTACCGAGTTGATAGAGGGACGAGAACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATATAGAGGAGCTGGCCATGAAATACGAGAGGCAATCCAGCATCCCGCAGACGAGAAGTTACAGGAGAAAGCATGGGGCGCGGTCGTTCCGCTCGTAGGCAAATTAAAGAAATTCTATGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTCCTGGGAGCCCTGACAAGTACCCCGTATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTACAGAAGAACGTTGAGTCGCATGAGGATTAATAATGTTCCAGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACCCCAATGCTGAAAACCTTAAGTGATGCCACCACAAAGTTTGTATCAGAGAATAAAAATTTACCAATAGAAAACACCACAGATTGTCTAAGCACCATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTCACAAATGAAGAGACGGTGTCATTCTGCTTGAGGGTTATGGTGGGCGTCATAATACTCTATGACCACGTACACCCCGTGGGAGCGTTTGCCAAAACTTCAAAAATCGACATGAAAGGTTGTATCAAGGTTCTTAAGGACCAGCCTCCTAATAGTGTAGAAGGTCTTCTCAACGCCCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATGACACTTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAGTGACTGAGAATGCACAGTTTTTTAGTGATTGCAATTACTATCTCATTTACTCTTGCTTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTATACTCTGAAGGGATATTGTCCTTTCAAACAGGCCGTCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAGAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCTTTTTTCATGTGCAGCCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAACCTTTTTTTAAATTAGTAAGACTTTTGTTTAAAGTTTTAAGTTTGCATTTTCACTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAACTGTGATGTGTGCGTAGAGTATTACGTATGCATGTTCATGTTTAAAGAATGGCTGTTGATAAAATAAAAATCAGCTTTCATTTTT