Transcript asmbl_25943

Sequence
Transcript Sequence for observation asmbl_25943 of TGE0032845:
CCAGAAGTGGATGTAAATCTGCCCAAGGCTGACATTGATGTCTCAGGGCCTAAAGTGGACATTGATGTTCCTGATGTGAACATTGAAGGACCAGATGCAAAGCTGAAGGGTCCCAAGTTCAAGATGCCTGAGATGAACATAAAAGCTCCCAAGATCTCTATGCCTGACTTTGATTTGCATCTGAAAGGTCCCAAAGTGAAGGGTGATGTGGATG