Transcript asmbl_254

Sequence
Transcript Sequence for observation asmbl_254 of TGE0032834:
CAGGCAGGTGTCCAGATGGGCAATGCCTGCTGGGAGCTCTACTGTCTGGAACATGGGATTCAGCCTGATGGGCAGATGCCCAGCGATAAGACCATTGGTGGAGGGGACGACTCCTTCACCACCTTCTTCTGTGAAACTGGAGCTGGAAAACATGTGCCTCGGGCAGTCTTTGTGGACCTGGAGCCTACTGTAATCGATGAGATCCGAAATGGCCCATACCGTCAGCTCTTCCACCCAGAGCAGCTTATCACTGGGAAAGAAGATGCAGCCAACAACTATGCCCGTGGTCATTACACCATTGGCAAGGAGATCATCGACCCAGTGCTGGACCGGATCCGCAAGCTGTCTGATCAGTGCACAGGACTTCAGGGCTTCCTAGTATTCCACAGCTTTGGAGGGGGCACCGGCTCTGGCTTCACCTCTCTGCTGATGGAGCGGCTTTCTGTTGACTATGGCAAAAAGTCCAAGCTGGAATTCTCCATCTACCCAGCCCCCCAAGTGTCCACGGCTGTAGTGGAGCCCTACAACTCCATCCTGACCACCCATACCACCCTGGAACACTCAGACTGTGCCTTCATGGTGGACAACGAAGCCATTTATGATATCTGCCGCCGTAACCTAGATATTGAGCGTCCAACCTATACCAACCTCAACCGCCTCATCAGCCAAATTGTCTCCTCCATCACAGCTTCCTTGCGCTTTGATGGGGCCCTCAATGTGGACCTGACAGAGTTCCAGACCAACCTGGTGCCCTACCCTCGCATCCACTTCCCCTTGGCTACCTATGCACCAGTCATTTCTGCAGAGAAGGCCTACCATGAGCAGCTGTCAGTGGCAGAGATCACCAATGCCTGTTTTGAGCCTGCCAACCAGATGGTGAAATGTGACCCTCGGCACGGCAAGTACATGGCCTGCTGCCTGCTGTACCGTGGAGATGTGGTGCCCAAAGATGTGAATGCTGCCATAGCTGCCATCAAGACGAAGCGCAGCATCCAGTTTGTGGACTGGTGCCCCACAGGCTTCAAGGTTGGCATCAACTACCAACCACCCACTGTGGTGCCTGGGGGTGACCTGGCCAAGGTGCAGCGTGCTGTGTGCATGCTGAGCAACACAACCGCCATTGCTGAAGCCTGGGCCCGTCTGGACCACAAGTTTGACTTGATGTATGCCAAGAGGGCTTTTGTACACTGGTATGTGGGTGAGGGAATGGAGGAGGGGGAGTTCTCTGAGGCTCGAGAGGATATGGCTGCCCTGGAAAAAGATTATGAGGAAGTAGGCATCGACTCCTATGAGGACGAGGATGAGGGAGAAGAGTAGACCGCTACTTGGAGCCTGTTCACTGTGTTTATTGCAAAATCCTTTCGAAATAAACAGTCTCCTTGCATGGTTTCTTGTCCCCTTTGTAACTGCTTGAGCCTCTGCTTGTCCCCCTTTCTGCTTTGGCTGCTACCTCCCGCTATTGGCCGCTTGTGACCTTTTAATTTTACCTTCACATGGCTGACAGTGAGACTTGCCAAGGGGGCCCCATATTGAGCCCCAGAAAGCAGGAACCCAAGGACTTCAATGTAAGGTCCTAAGGACTCGCAGAATAGGAAAGAAACAAGGACCAAACCCTGGACCTGTCTGTCTAGCTACAAGCTATTGCAAGATACAAGTCTTCACTTTCTGAAATATCTGATAGTCTGTGTTGGATGATTGGACTACTTTATTCTTCTTGCTGCTGCTTCACTCAACAGCTCTAGAAGGCTTGGCCCAGGCGTCATTGAACACTGAGGATTTGGGAATGGGGGCTGGGCGGGCCCAAAGTTCCCGGGCATACAGCCACCTCACAAACTTGGGGGATGGGCAGGAACAAGGGCAATCTAGTTGTTTGTGCCACAGCACCTCTGGCAGCTTTGCATAGCTTGCTGTCTATCTTGC