Transcript asmbl_10918

Sequence
Transcript Sequence for observation asmbl_10918 of TGE0000049:
GTCAGGCATTTTAAATTTGGGGCCCTTCAGTTTCCCTTCTGGACCATGAATGTCAATATCAGGAGTGTCAATGCCCACTTTAGGGCCTTTGACATCCACTTTGGGACCTTTCAGATCTCCCTCCAGTTTAGGAACGGAAATGTCCATATCTCCTTTTATCTTAGGTCCTTTCAAATTCAAATCAATGTCACTCATGGAGATTTGTGGGCTTTTGAAATGTACATCAGGCATCTTAAACTTGGGACCTTTGAGCTTCCCTTCAGGACCTTCAATGTCTACCTCTGGCCCTTTCAGATCACTTTCCACCTTAGGTAGTGAAACATCCACATCACCCTTCACTTTGGGTCCTTTCAGGTTTAAGTCAAT