Transcript asmbl_30310

Sequence
Transcript Sequence for observation asmbl_30310 of TGE0004804:
AAAAAAGTTCAGCGACACGCATCTGTGGGCTCTCTCCCACCCAGCGGTAACGAGCACCCCAAAGAAGACCTCAGCCTGCGACTGAAGAAGCTCACGCACGCCGCCCCCTGTATGTTGTTCATGAAGGGGACCCCGCAGGAGCCGCGCTGCGGTTTCAGCAAACAGATGGTGGAAATCCTTAACAAGCACAATATCCAGTTTAGCAGTTTTGATATCTTATCAGATGAAGAAGTTCGTCAGGGCCTCAAAACCTATTCCAATTGGCCCACCTATCCCCAGCTCTATGTGTCTGGAGAGCTCATCGGAGGACTTGACATAATTAAGGAGCTAGAAGCATCCGAAGAACTAGATACAGTTTGCCCTAAAGCTCCTAAATTAGAGGAAAGGCTCAAAGTACTGACAAATAAAGCTTCTGTGATGCTCTTTATGAAAGGAAGCAAACAGGAAGCTAAATGTGGATTCAGCAAACAAATTTTGGAAATACTAAATAGTACTGGTGTTGAATATGAGACATTTGATATATTGGAGGACGAAGAAGTTCGGCAAGGGTTAAAAACGTACTCCAACTGGCCGACGTACCCCCAGCTGTACGTGAAGGGGGAGCTCGTCGGAGGCCTGGACATTGTGAAGGAACTGAAAGAAAATGGTGAATTGCTGCCTGTGCTGAAGGGAGGAAATGAATAAGTGTTAAACCTGGTGCCCAGCCGTTTCGAGAAACATTTAGTCGGAGCGGAGCCGTTCCTGAGTTGGCCCTCAGAGAAAGACTAGGCGGGAAAACACTCTGCTGTCCCCGGTTCCGCTCTGTGTGGGCCACAAGGTTGCGCTACATAAATGTATGTTACGTTTTTTTCCACCAAAAATAGAATGTAATAAACATCTTCAAATTCAGTTAACAA