Transcript asmbl_24132

Sequence
Transcript Sequence for observation asmbl_24132 of TGE0002160:
AGCGTGGGCTGCGCCTGTCGCGAATCCGGTTCCGCCCTCCCCTTGTCAGCCCACCCTACGGAGAGAGCGCCCGAGCTCCCTTTCCCAGAGTGCTCCGCGCCGTGAAGAAGCGGCTCCCGGGGACTGGGGGCATTTTGTGTTGGCTGGAGCTAGAGTAACAAGATGGCGGCCTCGGCGGAGTGACGGCTTCCCTCCGGGCCGGAGCCGGCGGCAGTGGTGGCAGCGGTACCGCCCGCCCTCGTTCACCGCGCCCCTTTCCCAGCCCGCGACGTCGCCGCGACCACGAAAAAAAATCAGCGGCGGCCGCCCGAGAACAACAAGCGGCCGAGCTTCAGCAGCCGCGACCACCCTTCACGAACCGCGGCCTGGCCCTTCAGCGAGCGGCGGCGGCGGCGATCCGGCTTCTCTCTGCCGCCTGTGCGCCCCGTGACGCCGACAGAGCCTTGGGTTTAGGTTGCCCGCCGCGCTTCTCACTTCTGCCGCGGGTGGAACAGCCCCGGAGGCTTCCATCCTCTTCCTGAGGTGTCGGGGCTCGGCCCCCCGCCTCCATCTTCGCGTCTCAGGATGGCGAGCAGCAGCGGCTCCAAGGCCGAATTTATCGTCGGTGGAAAATACAAACTGGTGCGGAAGATCGGATCTGGCTCTTTCGGGGACATTTATCTAGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAACTAGAATCCCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACATACGGTGGTATGGGCAAGAAAAAGACTATAATGTACTAGTCATGGATCTCCTGGGACCCAGCCTTGAAGACCTCTTCAACTTCTGTTCAAGGAGGTTCACTATGAAGACCGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCTTTAGGATATGTTTTGATGTATTTTAATAGAACCAGTCTGCCGTGGCAAGGACTGAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAGGTGTTGTGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAATTACTGTCGTGGGCTGCGCTTTGAGGAAGCTCCGGATTACATGTATCTGAGGCAGCTATTCCGCATCCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACGATGTTAAAGCAGAAAGCAGCCCAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGTTTCTAAGCATGAATTGTGGAAGAGAAGCAGCAGAGCAGACGATTGGAGCAGCGTTTGTTTCTCCCCAAACCTAGACATTTTAGTTCATATGTACACTAGCCAGTGGTTGTGGACAACCATTTACTTGGTGTAAAGAACTTCATTTCGGTATAAACTGGCTCTGGGTAGCACTGCGGATCCTGAGCTGTAGCCACTGTCCTTGTGAATATTAACTGAGGTAGTGAAACATGGTGTCCGGTTTTCTATTGCATTTTTTTTCAAGTGGAAAAGTTAACTAAATGGTTGACACACAAATTGGTGGAGAAATTGTGCATATGCCAATTTTTATTTTATTTTTTTGTTAAAATCTTTTATTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTAAATGTTCACAATTGTGTGTTCTTAGGGTTTTCCATCCCTGGGGTTTGCAAGTTGTTAACTTAAAACATTCTTTAAATGGCTGGCTTCTTGTTTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATTTGAAAGACTCTGCCTGCTTACCTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAAAAACATAGCGACTACTAGATTCTCTTTAGGACTCTGCATTAACTCTATAATGTTCTTGCTATTAAAAAAAAGCATATTTGTCACGGAAATTTAGTTACCGTCTTACAACTGAACATGTATGTGTGTTGCTTAGATAAATGTAATCACTGTAAACATCTATACGATCTGGGATTTTGTTTTTATTTTGAAATGGGAGCTTTTTGTTTACAAGTTCATTAAAAACTAAAAACTGTTTCTGTAAGGAAGTGAAATTTTTTTAAACAACAAAATGCCTTGGCTGACTCACTATGAAGTGTGTGTGTGTGTGTGTGTACATATATATACATATATATGCACACATATATATACCATCCCCAGTTTTTTGTTTTGTTTTATATTTTGAGACAGAGTCTCATTTTGTAGCTCTAGCTGGCCTGGAACTTTATAGATCAGGCTGGCCTAGAACTCTCAGATCCTCCTGACTCTGCCTCTCTAAAGAGCTGGGACTGAAAAAAATGAGCCACCATGTCCAGCTTTCCCTAATTTTTTGATAGACTACTTCA