Transcript asmbl_24130

Sequence
Transcript Sequence for observation asmbl_24130 of TGE0002158:
AGCGTGGGCTGCGCCTGTCGCGAATCCGGTTCCGCCCTCCCCTTGTCAGCCCACCCTACGGAGAGAGCGCCCGAGCTCCCTTTCCCAGAGTGCTCCGCGCCGTGAAGAAGCGGCTCCCGGGGACTGGGGGCATTTTGTGTTGGCTGGAGCTAGAGTAACAAGATGGCGGCCTCGGCGGAGTGACGGCTTCCCTCCGGGCCGGAGCCGGCGGCAGTGGTGGCAGCGGTACCGCCCGCCCTCGTTCACCGCGCCCCTTTCCCAGCCCGCGACGTCGCCGCGACCACGAAAAAAAATCAGCGGCGGCCGCCCGAGAACAACAAGCGGCCGAGCTTCAGCAGCCGCGACCACCCTTCACGAACCGCGGCCTGGCCCTTCAGCGAGCGGCGGCGGCGGCGATCCGGCTTCTCTCTGCCGCCTGTGCGCCCCGTGACGCCGACAGAGCCTTGGGTTTAGGTTGCCCGCCGCGCTTCTCACTTCTGCCGCGGGTGGAACAGCCCCGGAGGCTTCCATCCTCTTCCTGAGGTGTCGGGGCTCGGCCCCCCGCCTCCATCTTCGCGTCTCAGGATGGCGAGCAGCAGCGGCTCCAAGGCCGAATTTATCGTCGGTGGAAAATACAAACTGGTGCGGAAGATCGGATCTGGCTCTTTCGGGGACATTTATCTAGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAACTAGAATCCCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACATACGGTGGTATGGGCAAGAAAAAGACTATAATGTACTAGTCATGGATCTCCTGGGACCCAGCCTTGAAGACCTCTTCAACTTCTGTTCAAGGAGGTTCACTATGAAGACCGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCTTTAGGATATGTTTTGATGTATTTTAATAGAACCAGTCTGCCGTGGCAAGGACTGAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAGGTGTTGTGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAATTACTGTCGTGGGCTGCGCTTTGAGGAAGCTCCGGATTACATGTATCTGAGGCAGCTATTCCGCATCCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACGATGTTAAAGCAGAAAGCAGCCCAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAAGCATGAATTGTGGAAGAGAAGCAGCAGAGCAGACGATTGGAGCAGCGTTTGTTTCTCCCCAAACCTAGACATTTTAGTTCATATGTACACTAGCCAGTGGTTGTGGACAACCATTTACTTGGTGTAAAGAACTTCATTTCGGTATAAACTGGCTCTGGGTAGCACTGCGGATCCTGAGCTGTAGCCACTGTCCTTGTGAATATTAACTGAGGTAGTGAAACATGGTGTCCGGTTTTCTATTGCATTTTTTTTCAAGTGGAAAAGTTAACTAAATGGTTGACACACAAATTGGTGGAGAAATTGTGCATATGCCAATTTTTATTTTATTTTTTTGTTAAAATCTTTTATTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTAAATGTTCACAATTGTGTGTTCTTAGGGTTTTCCATCCCTGGGGTTTGCAAGTTGTTAACTTAAAACATTCTTTAAATGGCTGGCTTCTTGTTTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATTTGAAAGACTCTGCCTGCTTACCTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAAAAACATAGCGACTACTAGATTCTCTTTAGGACTCTGCATTAACTCTATAATGTTCTTGCTATTAAAAAAAAGCATATTTGTCACGGAAATTTAGTTACCGTCTTACAACTGAACATGTATGTGTGTTGCTTAGATAAATGTAATCACTGTAAACATCTATACGATCTGGGATTTTGTTTTTATTTTGAAATGGGAGCTTTTTGTTTACAAGTTCATTAAAAACTAAAAACTGTTTCTGTAAGGAAGTGAAATTTTTTTAAACAACAAAATGCCTTGGCTGACTCACTATGAAGTGTGTGTGTGTGTGTGTGTACATATATATACATATATATGCACACATATATATACCATCCCCAGTTTTTTGTTTTGTTTTATATTTTGAGACAGAGTCTCATTTTGTAGCTCTAGCTGGCCTGGAACTTTATAGATCAGGCTGGCCTAGAACTCTCAGATCCTCCTGACTCTGCCTCTCTAAAGAGCTGGGACTGAAAAAAATGAGCCACCATGTCCAGCTTTCCCTAATTTTTTGATAGACTACTTCA