Transcript asmbl_24099

Sequence
Transcript Sequence for observation asmbl_24099 of TGE0032707:
GCCGCGCCAGCGCCCCCGCCACGCCGCTCAGCCCCACGCGCCTGTCGCGCCTGCAGGAGAAAGAGGAGCTGCGGGAGCTCAACGACCGCCTGGCTGTGTACATCGATAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACCGAGCGCGAGGAGGTGCGCGGCCGCGAGCTCACCGGCCTCAAGGCTCTCTACGAGACCGAGCTGGCCGACGCACGCCGCGCTCTGGACGACACGGCCCGCGAGCGCGCCAAGCTCCAGATCGAGCTGGGCAAGTTCAAGGCCGAGCACGACCAGCTGCTGCTCAATTATGCCAAGAAGGAATCTGATCTCAGTGGAGCCCAGATCAAGCTTCGAGAGTATGAGGCGGCACTAAACTCTAAGGATGCGGCGCTGGCTACTGCCCTAGGGGACAAAAAGAGTTTAGAGGGAGACTTGGAGGATCTGAAAGATCAGATTGCCCAGCTAGAAGCATCCTTATCTGCCGCCAAAAAGCAGTTAGCAGATGAAACTTTACTTAAAGTGGATTTGGAGAATCGCTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGTAAAAATATGTATGAAGAGGAGATCAATGAGACAAGGAGGAAGCATGAGACCCGCTTGGTGGAAGTGGACTCTGGGCGTCAGATTGAGTATGAGTACAAGCTGGCTCAAGCCCTGCATGAGATGCGGGAGCAGCACGACGCGCAGGTGAGGCTGTACAAGGAAGAGCTGGAGCAGACCTACCACGCCAAGCTTGAGAATGCCAGACTCTCCTCAGAGATGAACACTTCCACTGTCAACAGTGCCCGGGAAGAGCTGATGGAGAGCCGGATGAGGATCGAGAGCCTCTCCTCACAGCTCTCTAACCTGCAGAAAGAGTCTAGAGCGTGTTTGGAAAGGATCCAGGAATTGGAGGACATGCTTGCTAAGGAGAGAGACAACTCGCGCCGCATGCTGTCTGACAGAGAGAGAGAGATGGCGGAGATCAGGGACCAGATGCAGCAGCAGCTGAGTGATTATGAGCAGCTGCTGGACGTGAAGCTGGCCCTGGACATGGAGATCAGCGCCTACAGGAAGCTCCTGGAAGGCGAAGAAGAGCGGTTAAAGCTCTCTCCAAGCCCTTCTTCCCGGGTGACCGTGTCCAGAGCGTCCTCCAGTCGCAGTGTGCGCACCACCAGAGGAAAGCGGAAGAGAGTTGATGTGGAGGAGTCGGAGGCGAGCAGCAGTGTTAGCATTTCCCACTCTGCCTCAGCCACGGGGAACGTGTGCATTGAAGAGATAGATGTTGATGGGAAGTTTATTCGCTTGAAGAACACTTCTGAGCAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTACAAATATACCTCAAGATATGTGCTGAAGGCTGGCCAGACTGTCACAGTGTGGGCTGCAAATGCTGGCGTCACAGCCAGCCCTCCAACTGACCTCATCTGGAAGAACCAGAACTCTTGGGGTACTGGTGAAGATGTGAAGGTTATATTGAAGAATTCTCAGGGAGAGGAGGTTGCTCAGAGAAGCACAGTCTTCAAGACCACCATACCC