Transcript asmbl_30247

Sequence
Transcript Sequence for observation asmbl_30247 of TGE0004797:
AGGTGTGGAGGCTGGAGGGGGAAGAACACTTACTATTTTTTTCCCCTTGGTCAGGGGCTGGCTCTCCCAGGTCACTTCCAGGAGATTAGCTCTGGGAGGCACAGGACTGGCATTTGGAGGAGCTCTGCTGAAGGACAGGCAGTATGTTAGGTAGTCACAGACATTGTCTCATCGAACGTTCACAGCCCTCTGGGGTAGATATTTTCCTCACTGAGCAGATGGGGAACTCGAGCTCAGAAAAGTTGTCAGCCGTGGGGAAAGGAAGGTTAGGGCAATGGAGTTTGGCAGGTGACCTGGGACCATGAGAAGTGACGATGTTCACTCTGCTTCCCATGGTAGCTGGTGTGGAGAGGGTCTCAGCAATGACAAGAGAGGGAGTCAGAGGAATGAGCTATTTCCATCCTTAGACCATTCTTTCCTTCCCAACTTGTGACCTCTCTGAGGCCAGGGATGGGTTTGGCCTCATTTGGTACCTCTTCGGATGAACTCTGGGCACCACCCCACGTTGATACCTGTGGCCAGGCTAGGCTCCTCTTGACCAGCCATGCCCATGTCTGCTTGGCATCCACCTACCCGGCCTTGCCCCTGTAGACTTAGCCTCCATCAGTACGGCTCCCTTGAGCAGGGCCAGTCTCGGGCCTTCAGGGCAGCACTTGTTGCTGGTCTGGACAGGCAGGTCCTTGGCTTCAGGTTTTCCCTGGAGGATTTGGCTTCTTGGTTACTCAGGGGAAGCTACTACAGTGGTGAGAAACGGCATGAAGGAAAGTCCATGGGTAGATCAGTTTGCGTTTCTCTCTTTCTCTCTCTTCCCTGTGGCTCCCCTGAGGAAATGCAGCTTCTTGGCCAAGAGCTCTTGGGCTTTGCTGTCTTCCTAGACCTTGCCAGGGGTAGATAAGTTTGAGCCTTTTCAGCTGCAGGCCAGAGGCTGAGCTGACCTGGCAAAGAGCTAGCATTTTTGAGTTCCAGCTTCTGGGCTAGCGGAGACATGAGTTGGAGGTAACCCCATAACCTGAGACAGCCAGTGAACCGCCTCACACCTAGCTGGAAAAAGACACCTGCTGGCTTTATTTTGGGGGACAATGTGGCTTCCTCCAGAAGGCCTCTCCAGTGTATCTGTGGCCAATCTTGGCAAAAAAAGAATGCTCTGGATTAGGGATTGTCAAACTATGGCCCATAGGGTAAACACAGCCTGCTGTTTGTATAAAGTTTTACTGGAACAAAGCCATGCTCATTTGTTTATGTACTGTTTAAGGCTGCTGTTATGAAACAATAGCAGAAATGGCCTGCAAAGCCTAAAATACTTATTGTCTGGTAATTTACAAAAAAGCTCACTGACCCCTGGCTCCAGAATGCCCAAGATCTGGTCTCCTGTTTCTCCGGTCTCCAAGTTTGGAGAAGCCCCTGGCCTAGATGGGCAATGCCATGAAAACAATATCAGGAAGAAAGGGGAGAAAGATAAACATCTAGGAGGGTTGGGCAGCCACAGAGCTAGACCTGCCCGGCACAAGTGAAAGTGGGGCTGCTCTCTCACCCCGATCTTCCCCGTTGCTGGCTGGTGCTGCTGTAGCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATATCTA