Transcript asmbl_18150

Sequence
Transcript Sequence for observation asmbl_18150 of TGE0000489:
GCTGCCGCTCTGGCTTGCCGCCCCCCGCCGCCGCTGCACACCGGACCCAGCCGCCGTGCCGCGGGCCATGGACCTGCCCAGGGGCCTGGTGGTGGCCTGGGCGCTCAGCCTGTGGCCAGGGTTCACGGACACCTTCAACATGGACACCAGGAAGCCCCGGGTCATCCCTGGCTCCAGGACCGCCTTCTTTGGCTACACAGTGCAGCAGCACGACATCAGTGGCAATAAGTGGCTGGTCGTGGGCGCCCCACTGGAAACCAATGGCTACCAGAAGACGGGAGACGTGTACAAGTGTCCAGTGATCCACGGGAACTGCACCAAACTCAACCTGGGAAGGGTCACCCTGTCCAACGTGTCCGAGCGGAAAGACAACATGCGCCTCGGCCTTAGTCTCGCCACCAACCCCAAGGACAACAGCTTCCTGGCCTGCAGCCCCCTCTGGTCTCATGAGTGTGGGAGCTCCTACTACACCACAGGGATGTGTTCAAGAGTCAACTCCAACTTCAGGTTCTCCAAGACCGTGGCCCCAGCTCTCCAAAGGTGCCAGACCTACATGGACATCGTCATTGTCCTGGATGGCTCCAACAGCATCTACCCCTGGGTGGAGGTTCAGCACTTCCTCATCAACATCCTGAAAAAGTTTTACATTGGCCCAGGGCAGATCCAGGTTGGAGTTGTGCAGTATGGCGAAGATGTGGTGCATGAGTTTCACCTCAACGACTACAGGTCTGTAAAAGATGTGGTGGAAGCTGCCAGCCACATTGAGCAGAGAGGAGGAACAGAGACCCGGACGGCATTTGGCATTGAATTTGCACGCTCAGAGGCTTTCCAGAAGGGTGGAAGGAAAGGAGCCAAGAAGGTGATGATTGTCATCACAGATGGGGAGTCCCACGACAGCCCAGACCTGGAGAAGGTGATCCAGCAAAGCGAAAGAGACAACGTAACAAGATATGCGGTGGCCGTCCTGGGCTACTACAACCGCAGGGGGATCAATCCAGAAACTTTTCTAAATGAAATCAAATACATCGCCAGTGACCCTGATGACAAGCACTTCTTCAATGTCACTGATGAGGCTGCCTTGAAGGACATTGTCGATGCCCTGGGGGACAGAATCTTCAGCCTGGAAGGCACCAACAAGAACGAGACCTCCTTTGGGCTGGAGATGTCACAGACGGGCTTTTCCTCGCACGTGGTGGAGGATGGGGTTCTGCTGGGAGCCGTCGGTGCCTATGACTGGAATGGAGCTGTGCTAAAGGAGACGAGTGCCGGGAAGGTCATTCCTCTCCGCGAGTCCTACCTGAAAGAGTTCCCCGAGGAGCTCAAGAACCATGGTGCATACCTGGGGTACACAGTCACATCGGTCGTGTCCTCCAGGCAGGGGCGGGTGTACGTGGCCGGAGCCCCCCGGTTCAACCACACGGGCAAGGTCATCCTGTTCACCATGCACAACAACCGGAGCCTCACCATCCACCAGGCTATGCGGGGCCAGCAGATAGGCTCTTACTTTGGGAGTGAAATCACCTCGGTGGACATCGACGGCGACGGCGTGACTGATGTCCTGCTGGTGGGCGCACCCATGTACTTCAACGAGGGCCGTGAGCGAGGCAAGGTGTACGTCTATGAGCTGAGACAGAACCTGTTTGTTTATAACGGAACGCTAAAGGATTCACACAGTTACCAGAATGCCCGATTTGGGTCCTCCATTGCCTCAGTTCGAGACCTCAACCAGGATTCCTACAATGACGTGGTGGTGGGAGCCCCCCTGGAGGACAACCACGCAGGAGCCATCTACATCTTCCACGGCTTCCGAGGCAGCATCCTGAAGACACCTAAGCAGAGAATCACAGCCTCAGAGCTGGCTACCGGCCTCCAGTATTTTGGCTGCAGCATCCACGGGCAATTGGACCTCAATGAGGATGGGCTCATCGACCTGGCAGTGGGAGCCCTTGGCAACGCTGTGATTCTGTGGTCCCGCCCAGTGGTTCAGATCAATGCCAGCCTCCACTTTGAGCCATCCAAGATCAACATCTTCCACAGAGACTGCAAGCGCAGTGGCAGGGATGCCACCTGCCTGGCCGCCTTCCTCTGCTTCACGCCCATCTTCCTGGCACCCCATTTCCAAACAACAACTGTTGGCATCAGATACAACGCCACCATGGATGAGAGGCGGTATACACCGAGGGCCCACCTGGACGAGGGCGGGGACCGATTCACCAACAGAGCCGTACTGCTCTCCTCCGGCCAGGAGCTCTGTGAGCGGATCAACTTCCATGTCCTGGACACTGCTGACTACGTGAAGCCAGTGACCTTCTCAGTCGAGTATTCCCTGGAGGACCCTGACCATGGCCCCATGCTGGACGACGGCTGGCCCACCACTCTCAGAGTCTCGGTGCCCTTCTGGAACGGCTGCAATGAGGATGAGCACTGTGTCCCTGACCTTGTGTTGGATGCCCGGAGTGACCTGCCCACGGCCATGGAGTACTGCCAGAGGGTGCTGAGGAAGCCTGCGCAGGACTGCTCCGCATACACGCTGTCCTTCGACACCACAGTCTTCATCATAGAGAGCACACGCCAGCGAGTGGCGGTGGAGGCCACACTGGAGAACAGGGGCGAGAACGCCTACAGCACGGTCCTAAATATCTCGCAGTCAGCAAACCTGCAGTTTGCCAGCTTGATCCAGAAGGAGGACTCAGACGGTAGCATTGAGTGTGTGAACGAGGAGAGGAGGCTCCAGAAGCAAGTCTGCAACGTCAGCTATCCCTTCTTCCGGGCCAAGGCCAAGGTGGCTTTCCGTCTTGATTTTGAGTTCAGCAAATCCATCTTCCTACACCACCTGGAGATCGAGCTCGCTGCAGGCAGTGACAGTAATGAGCGGGACAGCACCAAGGAAGACAACGTGGCCCCCTTACGCTTCCACCTCAAATACGAGGCTGACGTCCTCTTCACCAGGAGCAGCAGCCTGAGCCACTACGAGGTCAAGCCCAACAGCTCGCTGGAGAGATACGATGGTATCGGGCCTCCCTTCAGCTGCATCTTCAGGATCCAGAACTTGGGCTTGTTCCCCATCCACGGGATGATGATGAAGATCACCATTCCCATCGCCACCAGGAGCGGCAACCGCCTACTGAAGCTGAGGGACTTCCTCACGGACGAGGCGAACACGTCCTGTAACATCTGGGGCAATAGCACTGAGTACCGGCCCACCCCAGTGGAGGAAGACTTGCGTCGTGCTCCACAGCTGAATCACAGCAACTCTGATGTCGTCTCCATCAACTGCAATATACGGCTGGTCCCCAACCAGGAAATCAATTTCCATCTACTGGGGAACCTGTGGTTGAGGTCCCTAAAAGCACTCAAGTACAAATCCATGAAAATCATGGTCAACGCAGCCTTGCAGAGGCAGTTCCACAGCCCCTTCATCTTCCGTGAGGAGGATCCCAGCCGCCAGATCGTGTTTGAGATCTCCAAGCAAGAGGACTGGCAGGTCCCCATCTGGATCATTGTAGGCAGCACCCTGGGGGGCCTCCTACTGCTGGCCCTGC