Transcript asmbl_21753

Sequence
Transcript Sequence for observation asmbl_21753 of TGE0032655:
CAAAATAGCCAGTTAATGTGGAAACAAGGCCGGCAGCTACTCAGGCAGTATCTCCAGGAGGTCGGCTACACAGATACTATTCTAGACGTGAAATCCAAGCGTGTGCGGGCATTGTTGGGCTTTTCAAGTGATGTCACTGACAGGGAGGATGACAAAAACCAGGACTCAGTGATAAATGGCACAGAGGCTGAAGTTAAAGAGACAGCAATGATTGGAAAATCCGAGCTAACGGATTCTGCCTCTGTGCTGGACAATTTCAAATTCCTTGAAAGTGCAGCTGCAGATGTCAGTGACGAGGACGAGGACGAGGACACTGATGGAAGAGCCAAGAGTGTCATTGATACTTCCACAATTGTTAGGAAAAAAGCATTGCCTGATACCAGTGAAGATCGAGACACAAAAGAAGCTCTGAAGGAGTTTGACTTTCTTGTCACATCAGAGGAAGGAGACAACGAATCTAGAAGCGCAGGCGATGGAACCGACTGGGAAAAGGAAGATCAGTGTCTCACGCCTGAAGCCTGGAATGTGGACCAGGGAGTGATCTCCAAACTGAAGGAGCAGTACAAAAAGGAGAGGAAGGGGAAGAAGGGGGTGAAGAGGCCCAATAGGTCAAAACTACAAGATATGCTTGCTAATTTGAGAGACGTTGATGAACTTCCCTCCTTGCAGCCATCTGTTGGCTCCCCTTCCAGACCCAGCAGCTCCAGGCTTCCAGAACAGGAGCTCAGTAGGGCAGATGAAGTGGAAGCGCTGACATTCCCCCCTTCTTCTGGGAAGTCATTTATCATGGGAGCAGACGAAGCCCTTGAGAGCGAGCTGGGGCTTGGAGAATTAGCAGGCCTCACGGTGGCCAATGAAGCAGACTCACTAGCTTATGATATAGCGAATAACAAAGATGCCTTGAGGAAGACGTGGAACCCTAAGTTTACATTAAGGAGTCACTTTGATGGCATCCGAGCCCTTGCTTTCCACCCCATTGAGCCTGTGTTAATAACAGCCTCAGAGGACCATACGCTGAAAATGTGGAATCTACAGAAAACAGCCCCAGCCAAAAAGAGTACTTCTCTAGATGTGGAGCCTATCTATACATTCAGGGCTCACAAAGGCCCGGTGCTGTGTGTGGTCATGAGTAGCAATGGTGAGCAGTGCTACAGCGGCGGGACTGACGGGCGGATCCAGAGCTGGAGCACCACCAATCCCAACGTCGATCCCTACGACGCTTACGATCCTTCAGTTCTAAGAGGCCCTCTGCTGGGCCACACGGACGCGGTATGGGGGCTGGCCTACAGTGCGGCACACCAGCGCTTGCTCTCCTGCTCAGCAGACGGCACTCTTCGCTTATGGAATACAACTGAGGTTGCTCCAGCACTGAGTGTATTTAATGATAACCAAGAGCTGGGAATTCCTGCCTCTGTGGATCTGGTGAGCAGCGACCCGAGCCATATGGTAGCATCGTTCAGCAAGGGATATACAAGCATCTTTAACATGGAAACACAGCAGCGAGTTCTCACGCTAGAATCCAATGTTGATTCAACATCCAGTTCTTCCTGCCAAATAAACAGAGTCATCAGCCATCCTACCCTCCCAATCAGCATCACTGCTCATGAAGACAGGCACATCAAGTTCTACGATAACAATACAGGCAAACTGATCCACTCGATGGTGGCCCACCTGGAAGCTGTGACAAGCCTGGCAGTTGACCCGAATGGCCTCTACTTGATGTCTGGCAGTCATGACTGTTCAATACGCTTATGGAATTTAGAAAGTAAGACATGTATCCAGGAGTTCACAGCTCATCGGAAGAAATTTGAAGAATCGATCCACGATGTAGCGTTCCACCCTTCCAAATGCTATATAGCCAGCGCTGGAGCCGACGCCCTGGCTAAGGTCTTTGTATGATGTGGCACAGCAGCTTCACCTTGTAGCTCTTTATAAAAGTCAACTGCACAACAGCGATACGGAAGACCAGGGCAAGAATCAGCTCGCCCTGCCCTTTTGTTCTGCTGAGGGAGCACAGAGAACTCTGTTAAAAGTATAGTTTTGCAATTCGTATACTGTTTTCTAAAATTAAGGTTTGTTCAGGTTGCTGCAAGCTCAGCCAAACCTGTGAGCCTGAAACTTTGAGATTTCCCTCCAAAGAGGCACTTTTGTTTCTGAAGTTGTTGTCATTCGCTAGGCTGGCCTGAGCGGGACAGGTTTAGCTTCTTCTCCCTTTCAAGTAAACAGGGCATGCTGTCATGGGTAATTAGAGTTGAGCGCCGGGAACGAGTAGAGTGGAAACCTCACTGTACTTCCTGCCACCCGGAGACATCTACTAGACACGAGGTAGTCAGTTGTACAGCTCTTTCTGCTCCACTAACCCCAGTGTGCAGAACGACCAGTCAGTGTTCAAGTGAGTTCCTACCACAGCTGTCCTTTCAGCCGCTCTCATAAAGCACATGGCAAAACATTTCACCTGCTAGGAGGAAACGATGCAATAATGTTAAGTGTATTACTATTCAGAAATGCTAAACAAATACTTAATTTGCAAGCAGATTTCTATATTGTACTACAGTTTTGAAAGTAGATGTGGAAGCATTCTAAAGTGAACTGTGAAGCACTCACAGTCAGGAGTGGGTACTAGAGCCTGCTTTACTAAAGGTTTGAACTCACCCAGGTTTGAGATCCTGTTTATTTTTAAGGGCAAACAGGGCATATTTCTATAATTTGTCTAAAAATTCACCTTGTTAATGTGGCATTTATAGTGCTAGCGTCATCATTTCATATTGATAAACTTACTTCCTAGTGATTCTGAAAAAGGGGAAAACTATTTATTAGCATCCATTTCCCAACACCCACATAACTAGTTCAAGTAAGCCTTGCTGTTTCTTCCCTGCCTTTCACGGTCATGTTGTCTGATGCTTACCATGAACAGTTTATAACTGGTCTGTCATGTAGTCCAAAGCATGTGGTCACTGCAGGCAGCTGCTTTTGCAGCCACGCCTAGTAGAGTAGTGCACCCCAGAAAGTCCTCTACTAGTGTCTCGGGAAAGAACTCTGTAGAGATCTAGATGGAGATGTTAGTGCCTGTGATGTCTACAAAGTTCTTTCTTCTCCCCACTCCCCATTGTTTAATTGGAATGCATGTTTTAATGAACAGTTGATCAATACTCTATCTAGAGAAAACCATGTCTTAAAATGCCAGCTCTCGCATTTATCTGTGAGCCGAATGTGGTCAGCTTTTGGGAGTCTCAGAATCCTACTGACACACCTAGGGCAGTCTTCACACCCTCTCTGCTTTTGTCCTAAATGACAGAGACCACTATAAATACTAAATTCAAATTAATCTCCACCTTTTTACCAAAATGTGTTCATCATAGGCTCTCTGTCTTAAAAATATTATACCCATAGATATTATGACCCATTAAACTAATTCCATTGCCATAGCCGTGGCTTTTCTGGTGATCTGTTCTTTGAAGTAGTATTCTTACGGTGATGTGGCTAATAATTGACTTCTTAAAAATTTCTGCTCATCTATCTTTAGAATTCTCCAGTGCAGGCAAACTTTTCTTACATTATAAGATTCGTGTTGAACGTCCCTGATTACTCTATAGACATGCTGTAGCACAACTACAGTTTATCTTTGTGCTTTGGTTAACAAGCAGGCTTTAGAGATTCACTGGTATATGCAAGTGAATTGAGTTACACATAACTACCAAGGAAAGCTCACATTTTCATGTATAGAGTTTTATGCTGTGACAGGTAAACTCTTCCATACTTTGTAAAGTGAACAAAAGGATTTATTAACATTTGTAGAATATTAGAAGATTCCAGTCGTAAGTGGCATATTTATGATGGCTGAGCACAGTTACTGCTTCAGTGTACGTCTTACTCTTGTCATCAACACTCCAGATCCCAGGAGAGTCTGCCCTGTTCATTCTGTGCCTCGTAATTGAAGTTTTCTTGTTAATGGGTGGGACACAATCCTAAGATAGGCAAAGTGTAGTACAAATGACAGAACTGTTGAAAGTTGTTTAGGAAGTATGTTTTGTGCCATTGAAGACTGCACGGAGAAAGAGAGCCTTCTAAACTAGCCCTGTTTGCTGTCAACCTAGAAATGAGCCAACTGTCTTCCAACTGGATGGTAGCATGTACGTGTGTTTGACTTTCCCCATCCTATTGAAAAATCACAAGATGAACAGTTTCAAGATTCAAAACCCTTGAAATACTTTCATGGTTATTTACCAGATTGTAAATGTTTTGAGTGAGCTGTTTTGGAATAATATGAAAATCAGCAGGTAGGTTAGGTCCCTGCCTTATTTTCAGTGCTGTGGATGTGTCTCCGGGAGCTTACAGTACTTCTCAAAATGCAGCTGTCACTTGGAGCTCATTTGCTACTCAAACCATAGACAAATAGGTGATGGGATGACCTTCAGTATTTTTCTATTGAACAAAGTTACCAATTTTTGCCATTAAACAGATAATTAGTTATGCAAAGTATTTAGCTTTTGTAATCATTTAGTTGTAACTAAAAGGGGGAAATTGAGCTGTATCACTGATAATGAACTTTGTGAGAAATTATTTGTTTATCTGACTTCCATTCCTTCAGTATTCTTGCTATAAATTTCTTTTGGAG