Transcript asmbl_21362

Sequence
Transcript Sequence for observation asmbl_21362 of TGE0032577:
GCCGGCGCGCGCCGGGAGGAAGAGCTGGGATTTGGGCCGCGGCGGGAGCCCGAGTCGGCGTCACTCGAGTGCGCAGGCGCCTGGCGGTTACCGGTCTCGCCATGGAGCGGAAAGTGCTCGCGCTCCAGGCCCGAAAGAAAAGGACCAAGGCCAAGAAGGACAAAGCCCAAAGGAAGCCTGAAACTCAGCACCGAGGCTCTGCACCCCACTCCGAGAGCGACATCCCAGAGCAGGAGGAGGAGATTCTAGGGTCTGACGATGACGAGCAGGAAGACCCCAATGACTACTGTAAAGGAGGTTATCATCTTGTGAAAATTGGAGATCTATTTAACGGGAGATACCATGTGATTCGAAAATTGGGCTGGGGACACTTTTCCACAGTGTGGTTATCATGGGATATTCAGGGAAAGAAGTTTGTAGCAATGAAAGTAGTTAAAAGTGCTGAGCATTACACAGAAACAGCACTAGATGAAATCCGGCTGCTGAAATCGGTTCGCAACTCAGACCCGAATGATCCAAATGGAGAAATGGTTGTTCAACTACTAGATGACTTTAAAATATCAGGCGTTAATGGAACACATATCTGCATGGTGTTTGAGGTTTTGGGGCATCATCTACTCAAGTGGATCATCAAGTCCAACTATCAGGGGCTTCCGCTGCCTTGTGTCAAAAAAATTATTCAGCAAGTGCTACAGGGCCTGGATTACTTACACACCAAGTGCCGGATCATCCACACGGACATCAAACCAGAGAACATCTTGTTGTCTGTGAATGAGCAGTACATTCGAAGGCTGGCTGCAGAGGCCACAGAGTGGCAGCGCTCAGGAGCTCCCCCACCATCGGGGTCTGCAGTCAGCACTGCTCCACAGCCTAAGCCAGCTGACAAAATGTCAAAGAATAAGAAGAAGAAATTGAAGAAGAAGCAGAAGCGCCAGGCAGAATTACTAGAGAAGCGAATGCAGGAAATTGAGGAAATGGAGAAAGAGTCGGGCCCTGGGCAAAAAAGACCTAACAAGCAAGAAGAATCAGAGAGTCCTGTTGACAGACCCCTGACAGAGAACCCACCTAATAAAATGACCCAAGAGAAACTTGGTATAAAAGAGCATTGCAGCAGTGACTTGATGGCACACTTGACACTGGGTTATCTTGTTTGTAATGTTTGCTTTCATGTATGCAGCTCATCTCTGGGGGTGTCCTGTAAGAGTTCACATTGCTCTAATGGAGGCAGCTGGTAGACACTGCAGGGTAACTTGGTGCTTTCTCCTCAGAAGTGGAGATAAGACTTTGTAGCCACTGGGTAAAGATGAGGTCTTTGTCCTTCCATCAGGAGGTGGTAGAGGGCTGTTGTGTTAGTCTTGTTTTTCTGCCACTCAGGATAAGCTCAGGAGAGTGTTTTGATGATGTGAGAATTGTCCTGCTGCTCACTAGCACATACACACATGCATCCTTTTCTGTTTGTTCTTAGAAGAGTCAAATTCCATTGGCCAGGACCAGACACTCACGGAGCGTGGTGGAGAGGGTGGTGCGCCAGAGATTAATTGCAATGGAGTGATTGGAGTCGTTAATTACCCTGAGAACAGTAATAATGAGACACTGAGGCATAAAGAGGATCTGCATAATGCTAATGACTGTGATGTCCACACTTTGAAGCAGGAACCTAGTTTCCTAAACTCTTCAAATGGAGACAGCAGTCCATCTCAAGACACAGACTCTTGCACACCCACGGCCTCTGAGACCATGGTGTGCCAATCCTCTGCAGAGCAGTCACTCACCCGACAGGACATCACCCAGCTGGAGGAGAGCATTCGGGCAGATACACCTTCTGGGGATGAGCAGGAGCCCAATGGAGCCCTGGACAGCAAAGGAAAATTCTCTGCTGGAAATTTTCTTATTAATCCCCTTGAGCCAAAAAATGCAGAGAAGCTCCAAGTGAAGATCGCAGACCTCGGGAACGCCTGCTGGGTGCACAAGCATTTCACTGAAGATATCCAGACACGGCAGTATCGGTCTTTGGAAGTCCTGATAGGATCTGGCTACAACACCCCTGCTGACATCTGGAGCACAGCATGCATGGCCTTTGAACTAGCCACAGGGGACTATTTGTTTGAGCCTCATTCAGGGGAGGATTACACACGAGATGAAGACCACATCGCCCTGATCATAGAACTTCTGGGGAAGGTGCCTCGCAAGCTCATTGTGGCAGGAAAATACTCCAAGGAATTTTTCACCAAAAAAG