Transcript asmbl_30105

Sequence
Transcript Sequence for observation asmbl_30105 of TGE0004785:
GGAGTGGATCTGCTGCTCTGGCTACGGGAGAGTGACCCTGTGAGCATTGGGTCTTGTCGTGGCGATGGCCTCGTTCGTGACAGAAGTTCTGGCACACACGGGGAGTCTGGAGAAGGAGGATCTGGGCACTCGGATCAGCCATCTGACTCGGCGGGTGGAGGAAATCAAGGGTGAGGTGTGCAGTATGATCAGCAAGAAGTACAGTGAATTCTTGCCTAGCATGCAAAGTGCACAGGACCTTGTTACACAAGTGGACAAGCTATCTGATGACATTGACCAGCTGAAATCCAGGATAGAGAGTGAGGTCCGCCGGGATCTTCATGTATCAACCACTGAATTTACAGACTTGAAACAGCAATTGGAAAGAGACTCGGTAGTCCTCAGTTTGCTTAAACAGCTACAAGAGTTTTCTACTGCTATTGAAGAATATAATTGTGCATTAGCAGAGAAGAAGTATGTCACTGCTGCTCACCGTCTAGAAGAGGCACAGAACTGCTTGAAGTTATTAAAATCCAGAAAATGCTTTGATTTAAAAATGTCGAAATCTCTCAGCATGGAGCTTACGATACAGAAACAGAACATACTGTATCACCTTGGAGAGGAGTGGCAGAAGCTGATTATATGGAAGTTCCCACCATCAAAAGATATGAGCAACTTGGAATCTTGTCTACAAACAGAACTTCATTTATACACTGAACAGTCTCAAAACGAAGAGAAGACCCCTGTGCCACCAACCAGTTCTGTCCTCTTGGCATTTTCTATTCTAGGAGAGCTACATACCAAGCTTAAATCATTTGGTCAGATGCTGCTGAAGTATATTCTTAGGCCTTTGGCAACTTGCCCCTCCCTTTTTGCTGTGATAGAAAGGCAGCCTAACATCATTATTATTCGTTTTGAATCTGTGATGACTGACTTGGAACATCCATCACCATCTGAAGTTTTTGCGAAGATCAGACTGGTGTTGGAAGTGCTGCAGAAACAACTAGATTTCCCTCTTGATGCTGATCTAGAAAATGAAAAAACATCTAAGATCATATTGGCTGAGATGCTTGGTGACACGATCTGGGAAGACTTGTCTGAGTGCCTCATTAAAAACTGTTTGGTTTATTCTATCCCAACAAATAGCAGCAAGTTACAGCAGTATGAGGAGATCATACAATCCACTGAAGAATTTGAAAATGCCTTAAAGGAGATGAGGTTTTTAAAAGGAGATACTACTGATTTGCTGAAATATGCCCGTAACATCAATTCTCATTTTGCTAACAAGAAATGTCAGGATGTGATTGTGGCAGCTAGAAATCTAATGACCTCTGAAATTCACAACACTGTGAAGATTACTCCTGATTCTAAGATAAGTGTACCTGACTTACCCAGCCCTGATGTGGATGACAAGCTACAAGTACAGAAAATGTCCATAACTCAGTACAGTGAAGTGGTGAATTTAGAGCCTGAAAATACATTGGACCAACATTCCTTTTCTTTGCCCACATGTCGTGTCAGTGAATCTGCGAAGAAATTAATGGAACTTGCCTATCAGACTTTACTAGAGGCGACAACCAGCAGTGATCAGTGTGCTGTTCAACTTTTCTACTCAGTAAGGAATATCTTCCATTTATTCCATGATGTCGTACCAACATATCATAAGGAGAACCTTCAAAAACTGCCCCAGTTGGCTGCCATTCACCATAACAACTGTATGTATATTGCTCATCACTTGCTGACCCTGGGACATCAGTTCAGATTTCGTCTTGCTCCCATTCTTTGTGATGGCACTACTACTTTCGTGGATCTTGTACCTGGCTTTAGGAGACTTGGGACAGAGTGTTTTTTGGCCCAAATGCGAGCACAGAAAAGAGAACTTCTGGAAAGATTATCAAGTGCTAGGAACTTTTCAAACATGGATGATGAAGAGAACTATTCTGCAGCAAGTAAAGCAGTCCGTCAGGTACTGCACCAACTAAAGAGACTTGGAATTGTGTGGCAGGATGTCCTGCCCGTGAATATATATTGCAAGGCTATGGGGACTTTACTCAATACTGCAATTTCTGAGATCATTGGCAGAATCACTGCCCTAGAGGACATCTCTACTGAAGATGGTGATAGATTGTATTCCTTATGCAAAACAGTGATGGATGAAGGACCTCAAGTATTTGCACCTCTATCTCAGGAAAGCAAGAACAAGAAATATCAAGAAGAGGTTCCAGTCTATGTGCCAAAATGGATGCCATTTAAAGAATTAATGATGGTGTTACAGGCCAGCCTGCAAGAAATTGGGGATCGGTGGGCAGATGGAAAAGGGCCCTTGGCAGCTGCATTCTCTTCCAGTGAAGTAAAAGCTTTAATTCGTGCCTTGTTCCAGAACACAGAAAGAAGAGCAGCTGCCCTTGCTAAGATTAAATAGCTCCACCTTCCCGAGAAAGCCATGTCTTTACTATGGATTTCTCTCTTGGCATAATTACTCATTTAGAGACTTCTTAGAGTCACCCACTGGTTTTGGTGAACCAATATATCATGGAAGTTTTATTTCACCTAAGAACGCCTTACCTCTTGGCTTGTAGGAGGCCATGTTGAATAACTGGATGTTAAGATGTCAAGTGAAGCACCTTACTTTGTTGAATTTCTAGCCACCCTTCTTAGATAAGAAACTGTAGAGCAGCATTGTTTTATGTTACTTCTAGGGCCTTCTGGGAACCATATCCATTGTAAATGTAGGCCCTGGCCTCGGATCAAGGAATCCAGGAGATTCCAGGAGTCAGGGTAAAGAATTTGTGAGCAAACAGGAGATATATTTTGGGGGGTAGGGGAACCATATTTGGCTTTGCAGAAATTAAGAAGACTTCCTTTAAGATTTTTTCCAATAAATAATGCTTTTAA