Transcript asmbl_21257

Sequence
Transcript Sequence for observation asmbl_21257 of TGE0032569:
TGTGGCGGGCAGCCCAGCTCAGGCCCCGCCCCGCCCGCTGGGGTCCTGCGCTCCGTGCTGCGCGCGGCGGGCGCGGAGGGAAGTCCCGAGACAAAGGAGCGCCGCCGCCTCTGCCGCCGCGACGGTCCGGGCCGCGGTCGCCCAGGGACTTTGAATATGTCGGGGATCGCCCTCAGCCGCCTTGCGCAGGAAAGGAAAGCCTGGAGGAAGGACCACCCTTTTGGCTTTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCTCACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCATCCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAAGGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAAGCAGCGGCCCTGGGCTCCATGACGAGGAAGGGATTGGCTTGGCAAGAACTTGTTTACAACCTTTTGCAGATCTAAGTCGCTCCGTACAGTTACTAGTCGCCTGGGAGGGTTGAGCGGGCGCCATTTTCCATTTCCGCCACTGGCATATTCAGTCTTTTGTATTTTTGATTATTAAGTAAAACTTGCTTTTATTTTAATATTGATGTCAGTATTTCAACTGCTGTAAAGTGATAAACTTTTGTACTTGGTAAGCCCCTAGCAGCTAGTTTCTTTGCGTCGCGCTCGGATGCAGGCATGCTTCCCACTGTTCAGAGCTCTGGCTTCCATCTGGCTGTGTGACAGAACCACACTGTCCCTCCTTCCCTACCCTCGTCCTTCTCAGAAACCTGGGCTGTTGCTTATGAGCCTCAGATCCAAAGTTGGCCAGCATTTCCATCCTGCACCACTTCCTTTGTGTTTATATGGCGTTTCGTCTGTGTTGCTGTTTAGAGTAAATAAACTGTTTATATAAAGGTTTTTGTTGCATTATCATCATTAAAATGTGAGGAGGTATCTATCTCAGTACACCTGGCCCTCCTCACATGGCTGCAGTCCTTGCCAGGCACCAAGGCTGAGCCCCAGGACCAGCACCTAGGAGGTCTCAGCTTCTGCTAGGGATATGCCCAGGCCCCATGCAGCTCCATCTTCATCTGGTTCTTTGTAAATAGGACTGTGTACAGGGATGTGTTCTGTTCTCCCCACCTGGATCTTTGGGCCTTAAGGTACCAGGCAGCGTTGAGAGCCTCATGAAGTTGGAATCCGCATCCAGCCTTCGTAAACCCAGAAAGGTGAAAGACTGGCTGATCCAGACCAAGGCTGAGGCCAGGTGAGAGCCAAGGACAAACTGGCCTGCATTGATCTCCCTGCCTGTTAGCTGTACAGTGGGCCCTGCTGTGGCCTGAATGCTAGCTTCAGGCCTTTTGGTGCCCTGCCCTTGTACCTGGAAGAGGCAGCTCTGCCACCGGCCCGGGCAAACTCGGGTCCTCTAGAGCACCTGAGCACACAGCTCCTACACCTCCTGACCTGCATTCAACTCTGCCCTACGGCCCAGGAGACCAGCCTGCTGTGGCCTCGGCACAGGATGACCTCAGGTACTACTGTCCACATACTCCGCTTGCTGGAGCTGGGCTGGGTGAAGCTGCTCTTGGCAGTGGCCCACCTGGGCTGGGCTGGGTCTGTGATCTTAGGGCTTACAGAACACAGGGAGGTGCAGTGGACATAGGCGCAGTGATCAGTCTCCATCAGACTTGTTCCTGAGGCCCCTGGAAGACCCCTGACATGGGAACCAGGCACCAGTGGCTCAAGTTCAGGGACCAATCAAGGGGTGGCCAGGTCTGCAGCCAGGAGTCTTCACTCTGGAATTGGAGGGGCTTGTGCTCACACAGCTGGTGGCACCTGGATGGGCTGGGTTGCCAGTGCCTTGTGGGCACGTTTAGCCGCCAGTACAGTCGGGAGCCGAGCTTGGATGAACAGTTTGCAGCACAAGGCCTCACCTGGGGAGCTTAGGCTGGTGTGTGTGTGTAGCCTGCTCTCAGAATGTCTTATTTTGTAACAACTGACTACATTTAGTAATAGGTACACATGTATATGGTTAATATATGGAAATTCAATATATTTTATAGTTAAAGTATTCTAAAGTAACTGATGTTTCTAGCAAACTGTAGTGACCCCAGCTATGAAGTGTTCCTTTTGTACCACAGTCCTTGGATTACCAGAGATGTGAATCTTGTAACATAAGAATGTGGTCTGTGACCATCCTGTGTTAAGAGGGTGGGGTGGAGGGTATCCCAGCATGAAGCCTCATTGGTAAGGAATTGTGGGCAACAGATTAACCACTGTATCTACAAATGCTCTAATTAAAAC