Transcript asmbl_212

Sequence
Transcript Sequence for observation asmbl_212 of TGE0032564:
GCAAGACCAATGTGGGAGTCCTAGCTGCCAGAAGACCTGGAGGCCCCCAAGACCCACCACTTCAAGGTGAAGGCCTTCAAGAAGGTGAAGCCCTGTGGCATCTGCCGGCAGGCCATCACTCGGGAAGGCTGTGTTTGCAAAGTCTGCAGCTTCTCCTGTCATCGGAAATGCCAGGCCAAGGTGGCTGCCCCTTGCGTTCCTCCGTCCAGCCATGAACTGGTGCCCATCACCACAGAGACCGTACCCAAGAATGTAGTAGATGTGGGGGAAGGAGACTGCCGGGTTGGAAGTTCTCCGAAAAACCTGGAGGAGGGCGGCTCCATGAGAGTTTCTCCAAGCATACAGCCACAACCACAATCACAGCCTACCAGTCTCTCTAGAAACACGAGTGTGAGCCGAGCCATGGAAGACAGTTGTGAGCTGGACCTGGTGTATGTCACCGAACGCATCATCGCCGTGTCCTTCCCTAGCACAGCCAATGAGGAGAACTTCCGCAGCAACCTCCGTGAAGTGGCTCAGATGTTGAAGTCCAAGCATGGGGGCAACTACCTGCTATTCAACCTCTCTGAACAGAGGCCTGACATCACCAAGCTGCATGCTAAGGTCCTGGAATTCGGCTGGCCTGACCTGCACACACCGGCCCTGGAGAAGATATGCAGTGTCTGTAAGGCCATGGACACCTGGCTCAATGCAGACCCCCACAATGTCGTTGTTCTCCACAACAAGGGAAACCGAGGCAGGATTGGGGTTGTCATTGCAGCGTATCTGCACTACAGCAACATTTCAGCCAGTGCTGACCAGGCTCTGGACCGGTTTGCAATGAAGAGATTCTATGAGGACAAGATCGTGCCCATTGGCCAGCCATCCCAGAGGAGATATGTGCACTACTTCAGTGGCCTACTCTCTGGCTCCATCAAAATGAACAACAAGCCTTTGTTTCTGCATCATGTGATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGGTGCCGGCCCTTTCTCCGCATCTACCAAGCCATGCAACCTGTGTACACATCTGGCATTTACAACATCCCTGGAGACAGCCAGGCCAGCATCTGTATCACCATTGAACCAGGGCTGCTCTTGAAGGGAGACATCTTGCTGAAGTGTTATCATAAGAAATTCCGGAGCCCGGCTCGAGACGTCATCTTCCGAGTGCAGTTCCACACCTGTGCCATCCATGACTTGGGGGTTGTTTTTGGGAAGGAAGATCTGGATGAGGCCTTCAAAGATGATCGATTTCCTGACTATGGCAAAGTGGAGTTTGTCTTTTCCTATGGACCAGAGAAAATTCAAGGCATGGAACACCTGGAGAATGGGCCCAGCGTATCTGTAGACTATAACACTTCTGACCCCCTCATCCGCTGGGACTCCTATGACAACTTCAGTGGGCATCGTGAGGATGGCATGGAAGAAGTGGTGGGACACACCCAAGGGCCGCTGGATGGGAGCCTGTACGCCAAGGTGAAGAAGAAGGATTCCCTGAATGGCAGTTCGGGGCCTGTCACTACTGCACGGCCTGCCCTGTCAGCCACTCCCAACCACGTGGAACACACCCTGTCTGTGAGCAGCGACTCTGGCAACTCCACAGCCTCCACTAAGACAGACAAGACCGATGAGCCAGTCTCTGGGGCTACCACTGCCCCTGCTGCCCTGAGTCCTCAGGAGAAGAAAGAGCTGGACCGCCTACTAAGTGGCTTTGGTGTGGATAGAGAAAAGCAAGGCGCCATGTACCGGGCTCAGCAACTCAGATCCCATCCAGGCGGGGGCCCGACTGTGCCCTCCCCTGGCCGCCACATTGTCCCAGCCCAGGTTCACGTCAATGGTGGGGCCCTGGCATCTGAGCGGGAGACAGACATTCTAGATGATGAGCTGCCCATCCAGGACGGGCAGAGTGGGGGCAGCATGGGAACGCTGTCCTCCCTGGATGGGGTCACCAACACCAGTGAAAGTGGCTACCCAGAGACCCTGTCCCCACTGACCAATGGCCTGGACAAACCCTATTCCACAGAACCTGTGCTCAACGGCGGAGGCTACCCCTATGAGGCTGCCAACCGGGTGATTCCTGTCCACAGCAGTCACTCGGCCCCCATTCGACCCTCCTACTCTGCTCAGGAGGGTTTAGCTGGCTACCAGCGTGAGGGACCCCACCCAGCCTGGTCACAGCAAGTGACCAGTGCCCACTGTGGCTGTGACCCCAGTGGTCTATTCAGATCCCAGTCCTTTCCAGATGTGGAGCCCCAGCTGCCCCAAGCTCCAACCCGTGGGGGTAGTAGCCGAGAGGCTGTGCAGAGGGGTCTGAATTCATGGCAACAGCAGCAGCCCCACCCACCTCCCCGCCAGCAGGAGAGATCCCCACTGCAGAGTCTTGCCCGCAGCAAGCCTAGCCCCCAGCTGTCAGCAGAGACCCCCGTAGCTGCTCTCCCAGAGTTCCCAAGGGCAGCGTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAATATGTTGATGCTGGACCTGGAGCCAGCCTCCGCAGCTGCCCCTCTTCATAAGTCCCAGAGTGTCCCTGGGGCCTGGCCAGGGGCTTCTCCACTCTCTTCCCAGCCCCTCTTGGGGTCTTCCCGCCAGTCCCACCCACTTACCCAGTCCCGATCTGGCTATATCCCCAGTGGGCATTCTCTGGGAACCCCGGAGCTGGTCTCTTCTGGCAGGCCTTATTCACCTTACGATTATCAGCTGCATCCAGCTGGATCCAACCAGAGTTTCCATCCAAAAAGTCCAGCCTCTTCCACCTTCCTTCCAAGCCCTCATAGCTCTGCGGGGCCTCAGGAGCCCCCAGCCTCTCTCCCTGGTCTCATCGCTCAGCCCCAGCTCCCACCAAAGGAAACTACATCAGATCCCTCCCGAACTCCAGAGGAAGAGCCGCTGAACCTGGAAGGGCTGGTAGCCCATCGGGTAGCAGGGGTTCAGGCTCGGGAGAGGCAGCCTGCAGAGCCCCCAGGCCCACTCCGGAGGCGGGCAGCCAGTGATGGACAGTATGAAAACCAGTCTCCGGAGGCCACATCCCCCCGTAGTCCTGGGGTCCGCTCCCCCGTCCAGTGCGTCTCCCCTGAGCTGGCTCTTACCATTGCCCTCAATCCTGGAGGGCGCCCCAAAGAGCCTCATTTGCATAGCTACAAGGAGGCCTTTGAGGAGATGGAGGGGACCTCCCCAAGCAGCCCGCCACACAGTGTGGCGCGCTCTCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCAGACATCTTGCTGCACCCCACAGGTGAGCCCCGGAGCTATGTGGAGTCCGTGGCGAGGACAGCGGTGGCAGGGCCTCGAGCTCAGGACGTTGAGCCTAAGAGCTTCAGCGCACCAGCTGCTCACGCCTATGGGCACGAGACACCCCTGAGGAACGGGACCCCAGGGGGCTCCTTTGTCTCCCCGAGCCCCCTCTCCACAAGCAGCCCCATCCTCAGTGCTGACAGCACTTCCGTGGGCAGTTTCCCATCAGTGGTGAGCAGTGACCAGGGTCCCCGGACACCCTTCCAGCCTATGCTGGACTCCAGCATCCGCTCAGGCAGCTTGGGGCAGCCGAGCCCTGCAGCACTGAGTTATCAGAGCTCCTCGCCTGTCCCTGTTGGTGGCAGCAGCTACAACAGCCCTGACTACTCCCTCCAACCATTCAGCTCTTCTCCAGAAAGCCAAGGCCAGCCACAGTACAGTGCGGCCAGTGTCCACATGGTACCTGGGAGCCCTCAGGCACGACACAGGACAGTGGGTACCAACACTCCACCTAGCCCTGGTTTTGGCCGGCGGGCCGTCAACCCCACCATGGCTGCCCCTGGTAGTCCCAGTTTGAGCCATCGGCAGGTGATGGGTCCATCTGGTCCAGGTTTCCATGGTAACGTGGTTTCTGGCCACCCAGCCAGTGCAGCTACCACTCCTGGAAGCCCCAGCCTGGGCCGGCACCCAGTGGGAAGCCATCAAGTTCCAGGCCTCCACAGCAGTGTGGTCACCACTCCGGGAAGCCCAAGCCTGGGCCGACACCCTGGTGCCCACCAAGGGAATCTGGCCTCCAGTCTCCACAGCAATGCAGTCATCAGCCCTGGGAGCCCAAGCTTGGGCCGGCACCTGGGTGGGTCTGGATCCGTGGTTCCTGGAAGCCCCAGCTTGGACCGGCATGCAGCTTATGGTGGCTACTCTACCCCTGAGGACCGAAGACCAACACTGTCCCGGCAAAGCAGTGCCTCTGGCTACCAGGCCCCATCCACACCGTCATTCCCTGTCTCTCCTGCCTACTACCCTGGCCTGAGCAGCCCTGCCACCTCACCCTCGCCAGACTCAGCAGCCTTCCGGCAGGGGAGCCCCACACCAGCCTTACCAGAGAAGCGAAGAATGTCAGTGGGAGACCGGGCAGGCAGCCTCCCCAACTATGCCACCATCAATGGGAAAGTGTCTTCCTCGCCTGTCGCCAATGGCATGGCCAGTGGGAGCAGCACCGTCTCCTTCTCTCACACGCTTCCGGACTTTTCTAAGTATTCGATGCCAGACAATAGTCCGGAGACTCGGGCTAAAGTGAAGTTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCCAGAGAACAGGCCATCGCACTCCTAAAGGACCAGGAGCCAGGAGCCTTCATCATCCGGGACAGCCACTCCTTCCGAGGGGCTTATGGGCTGGCCATGAAGGTGTCCTCACCCCCTCCAACCATCACTCAGCAGGGCAAGAAAGGAGACATGACCCATGAGCTGGTGAGGCACTTTCTGATCGAGACAGGCCCTAGAGGAGTGAAGCTCAAGGGTTGTCCCAATGAGCCAAACTTTGGTTCCCTTTCTGCCCTGGTCTATCAGCACTCCGTCATCCCACTGGCCCTGCCCTGTAAACTGGTCATTCCAAGCCGAGACCCCACAGATGAATCAAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGCTGAAGCAAGGAGCAGCTTGCAATGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACCGGGCCACAGGCCATTTCCAAAGCCACATCTGAGACTCTGGCTGCCGACCCCACACCGGCTGC