Transcript asmbl_21136

Sequence
Transcript Sequence for observation asmbl_21136 of TGE0032553:
CCACACGCGATGCGGGCCGTTCAGCTGGGACCGGTGCCCTCCGGGCCGCGCGTCGCGCTCCTGCCGCCGCTCCTGCTGCTGCTGCTCCTGGCGGCCGCGGGCTCCGCGCAGGCCCAGGCCGTCGACTTGGACGCCCTGTGCAGTTACACATGGGAAGCTGTTGACTCCAAAAACAATGCAGTTTATAAGATCAACGTCTGTGGAAATGTGGGTATTTCCAGCTGTGGGCCTACAAGTGCTATCTGTATGTGTGACCTAAAGACAGAGAACTGCCGCTCAGTGGGTGACTCACTTTTGAGAAGTTCAGCCAGATCACTCCTGGAATTCAACACCACTATGGGCTGCCAGCCTTCAGATTCACAGCACAGAATCCAGACTAGCATTACATTTCTGTGTGGGAAGACCCTGGGAACTCCTGAATTTGTAACTGCCACAGACTGTGTGCATTACTTTGAATGGAGGACTACTGCAGCCTGCAAGAAAGACATATTTAAAGCTGATAAGGAGGTACCATGCTATGCATTTGATGACAAGTTACAGAAGCATGATTTAAACCCACTGATCAAGCTAAATGGTGGCTATCTGGTAGATGATTCTGATCCTGACACGTCTCTGTTCATCAACGTGTGTAGAGACATAGACTCCCTTCGGGACCCCAGCACACAGCTGAGAGTCTGTCCTGCTGGCACTGCTGCCTGTCTGCTGAAGGGGAACCAGGCATTTGACGTTGGCCGACCCAAGGAGGGGCTGAAGCTGTTGAGCAAGGACAGGCTCGTTCTGACTTATGTGAAGGAAGAGGGAGAAAAGCCAGACTTCTGTAATGGTCACAGCCCTGCAGTGACAGTAACATTTGTGTGCCCATCTGAGCGGAGAGAGGGTACCATTCCTAAACTCACTGCCAAGTCCAACTGCCGTTATGAAGTTGAGTGGATCACCGAGTATGCCTGCCACAGAGATTACCTGCAAAGTGAGAGCTGCTCCCTCAGCAGTGAGCAGCATGATATTACTATTGACCTTAGTCCCTTGGCCCAATATGGAGGGTCCCCCTATGTTTCTGATGGAAGAGAATATACGTTTTTTATCAATGTCTGTGGGGACACAAAGGTCTCACTCTGTAATAACAAAGAGGCTGCTGTTTGTCAAGAGAAAAAGGCGGATTCCACTCAAGTCAAAATAGCAGGAAGACACCAGAACCAGACACTCCGGTACTCAGATGGAGACCTCACCCTCATCTATTCTGGAGGTGATGAGTGTAGCTCTGGCTTCCAGAGGATGAGTGTCATAAACTTTGAGTGCAACAAAACTGCAGGTAAGGATGGGAGAGGAGAGCCTGTGTTCACAGGTGAGGTGGACTGCACCTACTTCTTCACATGGGACACTAAATACGCCTGCATCAAAGAGAAGGAAGACCTCCTCTGCGGGGCCATCAATGGCAAGAAACGCTATGACCTGTCTGTGTTGGCTCGTCACTCAGAATCAGAACAGAATTGGGAAGCAGTGGATGGCAGCCAGGCAGAATCAGAAAAGTATTTCTTCATCAACGTCTGTCACCGGGTGCTGCAGGAGGGGAAGGCCAGGAACTGTCCTGAAGATGCTGCTGTGTGCGCTGTGGATAAGAATGGGAGTAAAAACCTTGGAAAATTTGTCTCTTCTCCTACAAAAGAGAAAGGACACATACAGCTCTCTTACACTGATGGTGATGACTGTGGCAGTGATAAGAAAATATCAACTAACATCACACTTGTGTGCAAACCAGGTGATCTAGAAAGTGCTCCAGTGCTAAGAGCTGCAAGATCTGATGGCTGCTTCTATGAGTTTGAGTGGCATACGGCTGCTGCCTGTGTACTGTCGAAGACAGAAGGAGAGAACTGCACGGTCCTTGATGCCCAGGCAGGGTTTTCCTTTGATTTGTCACTCCTCACGAAGAAGAATGGTGCATATAAAGTTGAGACAGAGAAGTATGACTTCTACATAAATGTTTGTGGCCCTGTATCCATGGATCCTTGTCAGTCAAACTCGGGGGCCTGCCAGGTAGCGAAAAGTGGTAAGTCTTGGAACTTGGGGCTGAGTAGTACTAAGCTCACCTACTACGACGGAATGATCCAGCTGAGCTACAGGAACGGCACTCCCTATAACAATGAAAAGCACACACCGAGAGCCACACTGATTACCTTCCTCTGTGACCGTGACGCTGGAGTGGGCTTCCCAGAATATCAGGAAGAGGACAACTCTACCTACAACTTCCGGTGGTACACCAGTTATGCCTGCCCAGAAGAACCCCTGGAGTGCATGGTGACAGACCCCTCCATGATGGAACAGTATGACCTCTCCAGTCTAGTGAAGTCTGAAGGTGGCTCTGGAGGAAACTGGTATGCTATGGAAAACTCCCGGGAACATGTTACACGGAGGAAATACTACCTCAATGTGTGTCGGCCTCTGAATCCTGTGCCAGGCTGCGATCGATATGCATCTGCTTGCCAGATGAAATATGAAAATCATGAGGGCTCCTTGGCAGAGACTGTATCCATCAGTAACTTGGGAGTTGCAAAGATAGGCCCTGTGGTGGAGGAGAGTGGCAGCCTCCTCTTAGAGTATGTGAACGGCTCTGCTTGCACCACCAGTGATGGCCAGCTCACCACCTACAGCACCAGGATCCATCTTGTCTGTGGTCGAGGATTTATGAACTCCCATCCCATATTCACTTTCAACTGGGAATGTGTGGTCAGTTTCTTGTGGAACACGGAGGCTGCCTGCCCTATCCAGACAATCACAGAAACAGACCAGGCTTGCTCAATAAGGGACCCCAGCAGTGGGTTTGTGTTTAATCTTAGCCCACTCAACGATTCTGCTCAAGGACATGTGGTCTTAGGCATCGGAAAGACTTTTGTGTTCAATATCTGTGGTGCAATGCCTGCCTGTGGAACGGTTGCGGGGAAGCCAGCCTATGGCTGCGAGGCCGAAACTCAGATAGAAGATATTAAGGACCTAAGGCCACAAAGGCCGGTCGGGATGGAGAGGAGCCTCCAGTTGTCTGCCGAGGGATTCCTCACTCTGACCTACAAGGGCTCTTCTCCCTCTGACAGAGGCACAGCATTCATCATCCGTTTTATTTGCAACGATGACATTTACCCAGGAGCCCCCAAATTCCTGCATCAGGACATTGACTCCACACGAGGGATCCGGAACACTTACTTTGAGTTTGAAACTGCATTGGCTTGTACTCCTTCTCTAGTGGATTGTCAAGTGACTGACCCAGCTGGGAACGAGTATGACTTGAGCGCCCTGAGCATGGTCAGGAAGCCATGGACTGCCGTGGACACGTCTGCATACGGGAAGAGGAGGCACTTCTACCTGAGTGTCTGCAACCCTCTGCCTTATATCCCTGGCTGCCACGGCATTGCATTGGGGTCCTGCATGGTGTCAGAAGACAACAGTTTTAACTTGGGTGTGGTGCAGATCAGTCCTCAAGCTACTGGAAATGGGTCTCTCAGCATCCTGTACGTGAATGGGGACAGATGTGGGGACCAGCGCTTCTCCACCAGGATCGTGTTCGAGTGTGCCCAGACGTCGGGCTCACCTATGTTCCAGTTCGTGAACAACTGTGAGTATGTGTTTGTGTGGCGAACAGTGGAGGCCTGCCCTGTGATCAGAGAGGAAGGAGACAACTGCCAGGTGAAGGACCCCAGGCATGGCAATTTGTATGACCTGAAGCCCCTGGGCCTCAATGACACCATCGTCAGTGTTGGCGAGTACACCTACTACTTGCGGGTCTGCGGGAAGCTGTCATCAGATGTCTGCTCTGCCCATGACGGATCCAAGGCAGTCTCATCATGCCAGGAAAAGAAAGGACCACAGGGATTCCAGAAAGTGGCAGGACTCCTTAGCCAGAAGCTGACTTTCGAAAACGGACTGTTGAAAATGAACTATACTGGGGGGGATACCTGCCATAAGGTGTATCAGCGCTCCACAACCATCTATTTCTACTGTGACCGGACTACACAGAAGCCAGTGTTTCTGAAGGAAACTTCGGACTGCTCCTATATGTTTGAGTGGCGAACACAGTATGCCTGCCCACCTTTCAATGTGACAGAGTGTTCTGTCCAGGATGCGGCTGGCAACTCCATTGACCTCTCCTCACTGTCAAGGTACAGTGACAACTGGGAGGCTGTGACCAGGACAGGGGCCACTGAGCATTACCTCATCAATGTATGCAAGTCTCTGTCTCCACACGCTGGCACAGAGCCATGCCCTCCAGAGGCAGCTGTTTGTCTGCTGAATGGCTCTAAGCCTGTGAACCTTGGCAAGGTGAGGGATGGCCCTCAGTGGACAGACGGTGTGACTGTCCTGCAGTATGTGGATGGTGACTTGTGCCCAGACAAAATTCGGAGAAGGTCAACCATTATTCGCTTCACCTGCAGTGACAACCAAGTGAACTCCAGGCCCCTTTTCATCAGTGCTGTTCAGGACTGTGAGTACACCTTCTCCTGGCCCACCCCTTCTGCCTGTCCTGTGAAGAGCAACACACATGATGACTGCCAAGTCACCAACCCCAGCACAGGCCACCTGTTTGACCTGAGCTCCTTAAGTGGCAGAGCTGGTATCAATGCCTCCTACAGCGAGAAGGGGCTGGTCTTCATGAGCATCTGTGAGGAGAATGAGAACTGTGGCCCCGGAGTAGGGGCCTGCTTTGGACAGACGAGGATCAGTGTGGGCAAGGCCAGCAAGAGGCTGAGCTACAAGGACCAAGTCCTGCAGCTGGTGTATGAGAATGGGTCCCCATGCCCTTCCCTGTCAGACCTGAGGTACAAGAGTGTCATCAGCTTTGTGTGCCGGCCTGAGGCTGGACCTACCAACAGGCCGATGCTCATCTCCTTGGACAAGCAGACGTGCACACTCTTCTTCTCCTGGCACACACCCCTGGCCTGTGAGCAAGCGACGGAGTGTACTGTGCGGAATGGAAGCTCGATTATTGACCTGTCCCCTCTCATCCACCGCACTGGTGGCTACGAAGCATACGATGAAAGTGAGGATGACACCTCTGACACCACCCCTGACTTCTATATCAACATCTGCCAGCCACTGAATCCCATGCACGGAGTGCCCTGCCCTGCAGGTGCCTCAGTATGCAAAGTTCCTGTGGACGGGCCCCCTATAGATATTGGCAGAGTCACAGGCCCTCCAATATTCAATCCTGTGGCGAATGAAGTCTACCTGAACTTTGAGAGCAGCACTCATTGCTTAGCCGACAGATATATGAACTACACCTCACTCATCACATTTCACTGCAAGAGAGGAGTCAGCATGGGAACTCCTAAGCTGATAAGGACCAATGACTGCGACTTTGTGTTTGAGTGGGAGACTCCGATTGTCTGTCCTGACGAAGTGAAGACACAGGGTTGTGCTGTAACAGATGAGCAGCTGCTCTATAGCTTCAACCTGACCAGCCTTTCCACAAGCACTTTCAAGGTTACTCGGGATGCCCGCACATACAGTATAGGGGTGTGCACAGCAGCAGCTGGCTTAGGCCAGGAAGGCTGCAAGGATGGCGGTGTCTGTCTGCTCTCTGGGAACAAAGGAGCTTCTTTTGGGCGCCTTGCATCGATGCAGCTGGATTACAGGCACCAAGATGAAGCAGTCATTCTGAGTTATGTGAATGGTGATCCTTGCCCTCCAGAAACGGATGATGGCGAGCCCTGTGTCTTCCCCTTCATTTACAAAGGGAAGAGCTATGATGAATGTGTATTAGAGGGACGAGCGAAACTGTGGTGTAGCAAAACTGCAAATTATGATCGTGACCACGAGTGGGGCTTCTGCAGACAGACCAACAGCTACCGGATGTCTGCGATCATATTTACGTGTGATGAAAGTGAAGATATTGGGAGACCACAAGTGTTCAGTGAAGATCGTGGGTGTGAGGTGACATTTGAGTGGAAGACAAAAGTTGTCTGCCCTCCAAAGAAGATGGAGTGCAAGTTTGTTCAGAAGCATAAGACCTATGACTTGCGACTGCTCTCATCCCTCACGGGGTCCTGGGACTTTGTGCATGAAGGAAACTCGTACTTTATCAATCTGTGCCAAAGAGTATACAAAGGTCCCCTGGACTGCTCTGAAAGAGCCAGCATTTGCAAGAAGAGTGCCACTGGTCAAGTCCAGGTTTTGGGGCTTGTTCATACACAAAAATTGGAAGTCATAGATGAAACGGTCATTGTTACTTACTCGAAAGGCTATCCTTGTGGTGGGAATAAGACTGCATCGTCTGTAATCGAATTGACCTGTGCGAAGACTGTGGGCAGGCCTGCATTCAAGAGGTTTGACAGTGTCAGCTGCACCTACTACTTTTACTGGTACTCACGGGCTGCCTGCGCGGTGAGGCCTCAGGAGGTGACCATGGTGAACGGAACGCTCACCAACCCTGTGACCGGCAAGAGCTTCAGCCTCGGCGAGATTTATTTTAAGCTCTTCAGCGCCTCTGGAGACATGAGGACCAATGGGGACAACTACCTGTATGAAATCCAGCTCTCCTCCATCACCAGCTCTTCTTACCCTGCATGCGCTGGTGCCAACATCTGCCAGGTGAAGCCCAATGACCAGCATTTCAGCAGGAAAGTAGGCACCTCTGACATGACCAAGTACTACGTCCAAGATGGAGATCTGGATGTGGTGTTTACCTCTTCCTCCAAGTGTGGGAAAGATAAGACCAAGTCTGTTTCTTCCACCATCTTCTTCCACTGTGACCCTCTGGTGAAGGATGGGATCCCAGAGTTCAGCCACGAGACCGCTGACTGCCAGTACCTGTTCTCCTGGTACACTTCAGCTGTGTGTCCTCTGGGTGTGGACTTTGAGGATGAGAGCGCAGGGCCAGAGTATAAAGGACTCTCAGAGCGGAGTCAGGCTGTTGGGGCAGTCCTCAGTCTTCTCCTGGTGGCGCTGACTGGCTGCTTGCTGGCCTTACTGCTGCATAAGAAGGAGAGAAGGGAAACTGTGATAAACAAGCTGACCAGCTGCTGCAGAAGAAGCTCGGGCGTGTCCTACAAGTACTCAAAGGTCAGCAAGGAGGAGGAGACAGATGAGAATGAGACAGAATGGCTGATGGAAGAGATCCAGGTGCCAGCCCCAAGACTAGGCAAGGACGGGCAAGAAAATGGCCATATCACCACCAAGGCGGTGAAAGCAGAAGCTCTCTCGTCCCTGCATGGGGACGACCAGGACAGTGAGGATGAGGTCCTGACCGTTCCAGAGGTGAAAGTTCACTCAGGCCGAGGAGCGGAGGTGGAAAGCTCACAGCCCCTGAGAAACCCACAGCGCAAGGTCCTGAAGGAAAGGGAGGGTGAGAGGCTGGGGCTGGTCCGAGGTGAGAAGGCCAGAAAAGGGAAGTTCAGACCCGGACAGCGCAAGCCAACAGCCCCTGCCAAGCTGGTGTCCTTCCATGATGACAGCGACGAAGACCTCTTACACATCTAACTCCGTGGTGCCTACAGAAGAAGGTGGAGCCATGGACAGCCAAGCACCTCCAACCAAATAAGACTTCAGCTCGATGATGCGTCTGTCATTTTGCCTTTAACAAAACTGCTTCAAAGGGAAGAGTTTCTGTAATGGGGGAGAGGATGGGGGAGGTGGGCACCACTCCTTCATGATCGTTTACAGTCAATGGAACAAGGTGTTGCTTGAATCGGCCAAAGGGCGGTACTTCGTGCCCAGGGGTTTGCCCCAAGTCCTCACTTACGATCATAGCTGCTGTGTGCTTCCAACAGGTGCCCAAGCCACATGCATCTCACAACAGAGGGCTGTGTTTGAAAAAAACCCTTGCTGCTTTAGACCCTACGGGGTGACCATTTATATTTTTAGCATTGTAATTCTCTCCCCTATTTATTGACTTTGACAATTACTACTCAGGTTTGCGAAAAAGGAAAAACAAAAACAAAAACAAAACCAGTTTCTTTTGCCAGCAAGGGCATAAGGTGAAGCTGGCCGTCTGCCGGAGCCGTTGTCCATGGCTCCTGAACTGGTCCTTGATGCACACTTAGTGAGCTGCAGTATTCTATTCTTCGCTTTGCATTTTGTGAGGGCACACACACATGCACAGGTCCCCGAGTGCCTAGGTTTGGGAAGGCCCACCTGCTCCGTGCCCTACCTCATCTCTGTAGTTGCAGCTCTTTGCACGAATCCCTCTGGGTGTTGCTCTTGCCAGCTGGTGACTCCCAGCAGCTCACCCAGGCGGGCGTTCGCGCACACGGTGGAGTGGAGGCTCTTGGGGAGGAGCTGCGCTTCAGGTTTGAGCTGTAGGTCTCATCTCTTCAGGGTCTCATAGTGCCACCTTTACTGTGCTTTTTG