Transcript asmbl_30018

Sequence
Transcript Sequence for observation asmbl_30018 of TGE0004781:
AATAGAGAAAGCTAAGAGGCTGCGGAGGGGGCGGGCCCGGCGTCCTCCCTCCTTGCAGATCCTGCGCCTGAAGAGACGCAGGCAGCTGACATTGTCTTCTTCGCGCGACTCTTTCTGCAGTCTGGAGAGTCCTCGGCCTCCTGTGCACAATGGCAACTCTTAAGGAAAAACTGATTGCACCAGTTGCAGAAGAGGCAGCGGTCCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTCGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCAGATGAGCTTGCTCTTGTGGATGTTTTGGAAGATAAACTCAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTACTCTGTGACTGCCAATTCTAAGGTGGTGGTGGTAACTGCAGGAGTCCGCCAGCAAGAGGGAGAGAGTCGTCTCAATCTGGTACAGAGGAATGTTAATGTCTTCAAATTCATTATTCCGCAGATCATCAAGTACAGTCCTGACTGCATCATAATTGTGGTTTCTAACCCAGTGGATATTCTCACATATGTTACCTGGAAACTAAGTGGATTACCCAAGCACCGTGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGGTTTCGTTATCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGAGAACATGGCGACTCAAGTGTGGCTGTGTGGAGCGGAGTGAATGTGGCAGGTGTTTCTCTCCAGGAACTGAATCCAGAAATGGGAACGGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCTTATGAAGTCATCAAGCTAAAAGGATACACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCAGTGTCAACTATGGTGAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTGAATGCTCGGGGATTGACCAGTGTTATCAACCAGAAACTGAAGGATGATGAGGTTGCCCAACTCAAGAAGAGTGCAGATACCCTGTGGGATATCCAGAAGGACCTCAAAGACCTGTGACTTCAGGCTTCTCGGCTGTAGAAATTTAAAAACTACAATGCAATTAACCATGAGCCTTTAGTTTCCAATTATGTACATGGATCACAGTTTGCTTTTATCTCCCTAAGTATGTGAATCTGGGCTCACAGAATCAAAGCCCATGCTTGATTTAATGCTTGCAATATGAGTCCTTGAACAAATAAAATTAACTATCATAGTGTG