Transcript asmbl_30017

Sequence
Transcript Sequence for observation asmbl_30017 of TGE0004781:
CTGGAGTGACTTGCTAGTTCTGCTTCAAAGGTGGATTCAAGGTGAAGTGCACAATGGCAACTCTTAAGGAAAAACTGATTGCACCAGTTGCAGAAGAGGCAGCGGTCCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTCGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCAGATGAGCTTGCTCTTGTGGATGTTTTGGAAGATAAACTCAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTACTCTGTGACTGCCAATTCTAAGGTGGTGGTGGTAACTGCAGGAGTCCGCCAGCAAGAGGGAGAGAGTCGTCTCAATCTGGTACAGAGGAATGTTAATGTCTTCAAATTCATTATTCCGCAGATCATCAAGTACAGTCCTGACTGCATCATAATTGTGGTTTCTAACCCAGTGGATATTCTCACATATGTTACCTGGAAACTAAGTGGATTACCCAAGCACCGTGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGGTTTCGTTATCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGAGAACATGGCGACTCAAGTGTGGCTGTGTGGAGCGGAGTGAATGTGGCAGGTGTTTCTCTCCAGGAACTGAATCCAGAAATGGGAACGGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCTTATGAAGTCATCAAGCTAAAAGGATACACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCAGTGTCAACTATGGTGAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTGAATGCTCGGGGATTGACCAGTGTTATCAACCAGAAACTGAAGGATGATGAGGTTGCCCAACTCAAGAAGAGTGCAGATACCCTGTGGGATATCCAGAAGGACCTCAAAGACCTGTGACTTCAGGCTTCTCGGCTGTAGAAATTTAAAAACTACAATGCAATTAACCATGAGCCTTTAGTTTCCAATTATGTACATGGATCACAGTTTGCTTTTATCTCCCTAAGTATGTGAATCTGGGCTCACAGAATCAAAGCCCATGCTTGATTTAATGCTTGCAATATGAGTCCTTGAACAAATAAAATTAACTATCATAGTGTG