Transcript asmbl_20969

Sequence
Transcript Sequence for observation asmbl_20969 of TGE0032523:
CGGCCGCGGACCGCCGGCGACGCACGAGCAGACCTCTCCCTGCTCCAGGAGGACCTGCCGGAGGACGCGGACGGACTTGATGTGGATGACTACAGCTCAGAGTCTGATGTGATTATTATACCTTCAGCCCTGGACTTCGTCTCACAAGATGAAATGTTGACACCCTTGGGGAGGCTGGACAAGTATGCTGCAAGTGAGAACGTATTTAACAGACAAATGGTGGCCCGGAGTTTGCTGGATACTCTGAGGGAAGTCTGCGATGATGAGAGAGACTGCATTGCTGTCTTGGAAAGAATTAGCCGATTAGCTGATGACTCCGAACCAACTGTGAGAGCGGAGCTGATGGAACAAGTGCCGCACATTGCACTGTTTTGTCAAGAGAACCGGCCTTCTATACCGTATGCTTTTTCCAAGTACTTACTACCAATTGTGGTCAGATACCTCGCAGACCAGAATAACCAGGTGAGGAAAACCAGTCAGGCAGCTTTGCTGGCTCTGCTGGAGCAGGAACTGATTGAGCGATTTGACGTGGAGACCAAGGTGTGCCCTGTCCTCATAGACCTGACTGCCCCAGACAGCAATGATGATGTGAAGACAGAAGCTGTGGCTATAATGTGCAAGATGGCCCCCATGGTTGGGAAGGACATTACGGAGCGCCTCATCCTCCCCAGGTTCTGCGAGATGTGCTGTGACTGTCGAATGTTTCATGTCCGGAAGGTCTGCGCTGCCAATTTTGGAGATATTTGCAGTGTAGTTGGCCAACAAGCAACAGAAGAAATGTTGCTGCCCAGGTTCTTCCAGCTGTGCTCTGATAACGTGTGGGGCGTCCGAAAGGCCTGTGCTGAGTGCTTCATGGCTGTCTCCTGTGCAACATGTCAAGAAATCCGACGGACAAAGTTATCAGCACTATTTATTAACTTGATCAGTGATCCTTCACGTTGGGTTCGCCAAGCAGCCTTTCAGTCTCTGGGGCCTTTCATATCCACGTTTGCTAATCCATCAAGCTCGGGCCAGTGCTTTAAAGATGAGAGCAAGAACTCAGAAGACTCCTCGGCAGAAGACAAAGACAGGATGAGAGACAATGATGTCGTAGAAGAAGAGCATCGCAGGCCAGAGGACGCTCCTTCAGACCTCAGTGCCCCTCACTCCAGCGCCAGGCTGGAGAGCCTCGAAGGCTGTGCTGCCAAGACACCTGGGCACTCTGCAGGTGACGTGCCTGCTCCAGTGGACAGCTCCTTACTCTGTACTTTGTCCTCAGAGTCTCCTCAGGAAGCAGCTAGCAATGATGAGAATGGTAGAAAGCCTGACACCAACAGCAAGTCTGCGTCCCGGCCAGACGCTGGCACCAGCTCCCCAGAGGCCACTCCCTTAGACCAGGACATGTTCAACTCCTTCCATTTCTGGAGGACTCCTCTACCTAAAATAGATCTTGATAAAGAGCTCCAGCAGGACCCCGAGGAGAGACTCAGCCCAGAGAGAACAGGAGATGTACCTGCAGCCCCTCTACCAGGCCCTCCCAATATCACCATGGCTACCCGGAAGGAACTAGAAGAAATGATAGAAAACCTTGAGCCACACATGGATGACCCGGATGTGAAAGCACAGGTGGACGTGCTGTCGGCTGCCCTGCGAGCTTCCAGCCTGGATGCTCACGAAGAGACTGGTGGTGTAGAGCAGCGGAGTGAGCTACAAGATGAAGTGTGTGTCAGTGAGCTTCCAGACTGTAACATAAGTCACGACACTTGTGTGCCTTTGATCAGCGCTGCTGAGGAGAATGCGGAGGCCACTCCTGATTATGTCCATGGAGGTGCAGACGTAAGCCCTGGTGATGGCTTCAGCCCGGATGAAGATAGGAGACCCAAAGTCCAGGATGTTGTACCACAAGCGTTACTGGATCAGTACTTGTCAATGACCGACCCTTCTCGAGCACAGACAGTTGACACTGAGATCGCTAAGCACTGTGCATACAGTCTGCCGGGTGTGGCCCTGACTCTTGGCAGACAGAACTGGCACTGCTTGAGGGAGACTTACGAGACCCTAGCGTCGGACATGCAGTGGAAAGTTCGAAGGACTCTAGCCTTCTCCATCCATGAGCTTGCAGTGATCCTTGGGGACCAGCTGACAGCTGCAGACCTGGTTCCAATCTTCAATGGATTTTTAAAAGACCTCGATGAAGTCAGGATAGGTGTTCTTAAACACTTGCATGACTTTCTGAAGCTTCTTCACATTGATAAAAGAAGAGAGTACCTTTATCAGCTCCAGGAGTTTTTGGTGACAGACAACAGTAGAAATTGGCGCTTTCGAGCTGAACTGGCAGAACAGCTGATTTTACTTCTGGAGTTATACAGTCCCAGAGATGTTTATGATTACCTACGACCCATCGCTCTGAATCTGTGTGCAGACAAAGTTTCTTCAGTCCGCTGGATTTCCTACAAGTTGGTCAGTGAAATGGTGAAGAAACTCCACACAGCAACACCACCAACCTTCGGAGTAGATCTCATCAATGAGCTGGTAGAGAATTTTGGCAGGTGTCCAAAATGGTCTGGTCGGCAAGCCTTTGTCTTTGTCTGCCAGACTGTCATTGAAGACGACTGCCTCCCCATGGACCAGTTTGCTGTGCACTTGATGCCACATTTGCTGACCTTGGCAAATGACAGGGTTCCCAATGTTAGAGTGCTGCTTGCGAAAACCCTGCGACAGACTCTGCTGGAGAAAGAGTACTTCTTAGCCTCTGCCAGCTGTCACCAGGAGGCCGTGGAGCAGACAATCATGGCCCTGCAGATGGACCGAGACAGTGATGTCAAGTACTTTGCAAGCATTCACCCCTCCAGTACCAAACTCTCTGAAGATGCAATGAGCACAGCTTCCTCCACCTACTGACCCACGGTGTCCATCCTGCATCCGCAAGAGCCTGGCCTCGACTGCCTGCACCACTCGGGACAGCTGTGGTGGGGGCCTTCCTCCTGCCAACTCATTCGCAGGTGCAGGTTGCCTACTCCCAATACCAGTGGTTTTAAGAGTCAAGAGAAAGTACAGTAAACACTATTATCTTATCTTGACTTAAGGGAAAGTAAATCTCAGAGGATTATAATTGTCACCAAAGCCTTAACTCGTTCCTTCATCTTCCTGACTGATGGCTTGAATTGGCAGAGCATTTTCCCTTCGGGAAGGATGAGGTTCCCAGAGACCTGCGTTGCTTTCTTCTGGTTTTATTTAACGGCTGATAAATGACATTCTTACGGCCAGAAGGTGGATGTGCACCGGACAGGAAAGGCCTTCAGTATTAGCCTAAGCATTTCTTCTAGGTGCTGAGCCTGTTCAGCTCCTTGGCTGCCCTGCCCAGCCCAGCCCTAAGTGTGAATAGTTCTTGGCGTGTATAAATGACAAAGGAGTTTTTCCTCTCCTAAGGGCTTGATGTTAACACTAAATAGAATCTGATTTTGACTCCTAATGCAGCACATTGCTGTACACATTTACAGAATGTTTGCAGAATCTCTCCTGATATTTTTCATGCTGGTCATGACCTGAAGGAAATTTCTTAGCACGAATATTGTGTCAGGTATTTTTAACTTGATCATGGTCAGCTCTGAGGTGCAACTGTGTCTTCCCGTGCTGCACCCCTGTGACCACTCTGGGGTGTGCAGCCTGAATCATGCTGTTAGAACTGTTGTGGTACAAGCTCCAAATAAAATTTATTAATAGGATCTATAAAGAGAGACACCACCCACTTTGTTTCC