Transcript asmbl_20947

Sequence
Transcript Sequence for observation asmbl_20947 of TGE0032516:
GGGGGCCGGGCGCGGGGCCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCGTCGCACCGTCTGTCTTTGTGTTTCAAAAGGACAAAGGACAGAAGAGATCTGCTGGCAGCTCCAGTCCCGAAGCCGGAGAAGATTCTGACCATGAGGATGGAAACTACTGCCCCCCTGTCAAGCGTGAGCGGACATCCTCTCTAACTCACTCAGAAGAGAAGAGCAGCGGCTTCCGGCTGAAGCCCCCAACACTCATCCACGGTCAGGCACCCAGTGCAGGTCTGCCCAGCCAGAAACCCAGGGAACAGCAGCGTGGTGTGCTCCGTCCAGCTGTGCTGCAGGCCCCTCAGCCCAAGGTGCTGTCGCAGACGGTTCCCAGCAGTGGCACCAATGGAGTCAGTATGCCAGCAGACTGCACGGGGCCAGCAACGTCTGTATCACCAGAAAACCTCACGCAGAGGAGTCCCTCTGAGTCTGCCGAGGAGACACACACACTCGAGGAGAAGGTGCCTCAGAAAACCCCACATGGCACCTCAGAGGAGGGGCACTGTGAAGAGGAGCAGGCGGCCCCACAGGCCTTTGTGTTTGGACAGAACTTGAGAGACAGAGTGAAGTTAATGAATGAGAATGCCAGCGTGGCAGATGTAGACAGTGCTGCACATCCCAGCTCAGAAACACCCTCTGCGACCAACTACTTCCTTCAGTACATCAGTTCCAGCGCAGACAACGCGACCCACAGTGCTGACAACTCCACCAAGTTTGTGTTTGGCCAGAACATGAGTGAGCGCGTCTTGAGCCCCCCAAAGCTGAATGAAGCCAATTCAGACACCAGCAGGGAGACTACACATGCCCAGTCAGGTTCTGAGTCGTCATCCCAGGAGGCCGCCCCCAAGAAAGAGTCCCTGGCAGAGTCAGCCGCTGCCTATACAAAGGCTACAGCGTGGACGTGTTTGCTGGAGAAGGTGGAGGTCATCACGGGGGAGGAGGCAGAGAGCAATGTGCTGCAGATCCAGTGTAAGCTGTTTGTGTTCGATAAGACCTCACAGTCATGGGTGGAGCGTGGCCGGGGACTTCTCAGGCTCAATGACATGGCGTCAACCGACGATGGCACATTACAGTCCCGGCTAGTGATGCGGACCCAGGGCAGCCTGCGGCTCATCCTGAACACGAAGCTGTGGGCACAGATGCAGATGGATAAGGCCAGTGAAAAGAGCATCCGCATCACAGCCACCGACGCTGAGGACCAGGGTGTCAAGGTTTTCCTGATCTCGGCCAGCTCCAAAGACACAGGCCAACTGTATGCTGCACTGCACCACCGCATCCTGGCTCTGCGTAGCCGGGCTGAACAGGAACAGGAGGCCAAGGCGCCCCCACCTGAGCCAGGAGCCACCCGGGCCACCGAGGAGGAAGACAGTGATGAGGATGCTGTTCTGGCTCCCTCCGGTGTCACGGGGGCTGGCACAGGTGATGAAGGAGATGGCCAGGCTCCTGGGAGCACATAGCGGCGGAGCCACTGCACCAGGCTGCTGCTTTGTTGTCTGTCTGCTGCCCGTCCCTCCCTGCAGGCCGCATCATGGTGGTGTCTATTGCCGGGGTGGCCACAGGCTGGATCCGAGTGTCCCCTCTGCAGCAGACGGGGACGCCAGGATGCGGCTTGGGACTCAGACCTCATCATATTGATGAGTAGAAAGAACGTTCCCCCGCCCTCCTCCGATCGAAATGGCACATTGACACTTGTCACAGCTTCGTGGTGACCGTCCATCCCTGGGCAGCAACAAAGAGAACTCCAGGCTCAGCATTCTGTTGAGTAACTTGCTACCTGCTCGGCTTTCCACTCTGCCAGGTCCACATGGCAGGTGCCTCTCCTTCATTTCTGGTGGCTTGGCTCTTGAGGTCACAGATGAAGCTACACGTGGGCTGAGCTGACTTGATGCTCCTATGGGTGGTGCCCGGCCCCCACGGGGGTTCACTAGGTTTGGGCCTGAGAACACCTGTCTGGACAAAGGTGATGAAACCAAGAGAGCTCCTGCCTTCTTGCCTGCCTACGTGAACCACCTGGGTCTCCCTTAGCAGGTACCCAGCCCTGAGGTGACTGACCACCTAGGGCCCCTGAGAGGCAAAGGGAACCTGCAAAGGGCCTGTCCCCGGGCAGAAGATGAAGCCCCTACCCGTGGACTGTGTGGTTCCATCTCTGGCCAGGCCACTTCCAGCCAGCAAGGACACCAGAGGCTGCCTTAGCAGATGGGTCACACTGCTTCCAGCCTTAGCCAGCCAGTGACAAGTGAATCCAGACGTCACCCATGTGTTTTGGAACATTTATGTAAGATTGAAATGTATTTGAGAACTGCATTAAAACTTTTAACTAAA