Transcript asmbl_20822

Sequence
Transcript Sequence for observation asmbl_20822 of TGE0032507:
CGGCGAGCGGGTGTGACCCCGGCGTCTGGGTTCGGTTCTGAAGTCCGGGCTTGGTCCGGGTGATCCCCAAACACTGACCGTTCTCATTTCCTTTTGGGAGTATTCATGCTTCACCATGTTGAGAGCTAAGAATCAACTTTTTTTGCTATCGCCCCATTACCTGAAGCAGCTAAACATTCCATCAGCTTCCAGATGGAAACGCCTTCTACACCAGCAGCAACCCCTTCACCCAGAATGGGCTGTACTGGCCAAAAAGCAGCTGAAAGGCAAAAACCCAGAGGACCTTATATGGCACACCCCAGAAGGGATCTCTATAAAGCCCTTATATTCCAGGGCAGATACTCTGGACTTACCCGAAGAACTTCCAGGAGTGAAGCCATTCACACGGGGACCATATCCTACCATGTATACCTATAGGCCCTGGACCATCCGTCAGTATGCAGGCTTTAGTACTGTGGAAGAAAGCAATAAATTCTATAAGGACAATATTAAGGCTGGTCAGCAGGGGTTGTCTGTTGCCTTTGACTTGGCAACACATCGTGGTTATGATTCAGACAACCCCAGAGTTCGTGGAGATGTTGGAATGGCTGGAGTTGCTATTGACACTGTAGAAGACACCAAAATCCTATTTGATGGCATTCCTTTAGAAAAAATGTCCGTTTCCATGACTATGAACGGAGCTGTCATCCCAGTCCTGGCAACATTTATAGTAACTGGGGAAGAGCAAGGTGTGCCGAAGGAGAAGCTCACTGGCACAATTCAGAATGACATCCTAAAGGAGTTTATGGTCAGAAATACTTATATTTTTCCCCCAGAGCCATCGATGAAAATTATTGCTGACATTTTCCAATACACAGCACAGCACATGCCAAAATTTAATTCCATTTCGATTAGCGGGTACCATATGCAGGAAGCAGGAGCTGATGCCATTTTAGAACTGGCCTATACCATCGCAGATGGGTTGGAGTACTGCAGAACTGGACTCCAGGCTGGACTCACAATTGATGAATTTGCACCAAGGTTGTCTTTCTTCTGGGGAATTGGAATGAACTTCTACATGGAAATAGCCAAGATGCGAGCTGGGAGAAGACTGTGGGCTCACTTAATAGAAAAAATGTTCCAGCCTAAAAACTCTAAATCTCTTCTTCTAAGAGCACACTGCCAGACATCGGGGTGGTCACTTACTGAGCAGGATCCTTACAATAACATTGTCCGCACTGCAATCGAAGCCATGGCAGCTGTGTTTGGAGGAACCCAGTCTTTGCATACGAACTCTTTTGATGAAGCGCTGGGTTTGCCCACTGTGAAAAGTGCCCGGATTGCTCGGAACACACAGATCATCATTCAGGAAGAATCTGGGATCCCCAAAGTGGCGGATCCTTGGGGAGGGTCGTACATGATGGAGTCGCTCACAAATGACGTTTATGAGGCTGCTCTGAAGTTGATATATGAAGTTGAAGAAATGGGTGGAATGGCCAAAGCTGTAGCTGAAGGAATCCCTAAACTTCGCATTGAAGAATGTGCTGCCCGAAGACAAGCTAGAATAGATTCTGGTTCTGAGGTAATTGTTGGAGTAAATAAGTATCAGTTGGAAAAAGAAGACTCTGTGGAGGTCCTGGCCATTGACAACACTTCAGTGCGTAAGAAGCAGATTGAAAAACTCAAGAAGATTAAATCCAGCAGGGATCAAGCTTTGGCTGAGCAGTGTCTCAGTGCACTTACCCAGTGTGCTGCCAGTGGAGATGGCAATATTCTGGCTCTGGCAGTGGATGCAGCTCGTGCAAGATGTACAGTTGGAGAAATCACGGATGCCTTGAAAAAAGTATTTGGTGAGCATAAAGCTAATGATCGTATGGTGAGTGGAGCATATCGGCAGGAGTTTGGAGAAAGTAAAGAGATCACATCTGCCATCAAGAGAGTTAATAAATTCATGGAACGTGAAGGTCGCAGACCTCGTCTTCTTGTGGCAAAAATGGGACAAGATGGCCATGACAGGGGAGCCAAGGTCATTGCTACAGGATTTGCTGATCTTGGTTTTGATGTGGACATAGGCCCTCTTTTTCAGACTCCCCGTGAAGTGGCGCAGCAAGCTGTGGATGCAGATGTCCATGCTGTGGGTGTCAGCACACTTGCTGCTGGTCATAAAACCCTCGTTCCTGAGCTTATCAAAGAACTCACCGCCCTGGGGCGGCCAGATATCCTTGTCATGTGTGGGGGCGTGATTCCACCACAGGATTATGAATTTCTGTATGAAGTTGGTGTTTCCAACGTCTTTGGTCCTGGAACCCGGATTCCAAGAGCTGCTGTCCAAGTGCTTGATGATATTGAGAAGTGTTTGGCAGAGAAGCAGCAGTCTGTGTAACATCTGGATCTT