Transcript asmbl_18114

Sequence
Transcript Sequence for observation asmbl_18114 of TGE0000487:
GGGTAGAAGGAGAAGGAGGGGAAGGGAGGGGGGGGTTGGGTGTCTACTCTGGTGAATAGACGGCTGTGGGGCAGAGAAGCGTGAAGGCCTGGCTGCCGGGCAGGTGAACTCTCCACGGGGTCTAGGGCCCGCGAAAGGGTTCGGAACCGAGTCAGCGCGCCTTGCGGGCAGGATTCACGCCGCTGTGACCCGGAGGTCCTCAGGGGGCGAAGCCCCGGCCTAGGCCTCGCGGAGATGCCCAGCTGCGGTGCTTGTACTTGCGGCGCGGCGGCCGTCCGGCTCATCACCTCCTCACTCGCCTCCGCGCAGAGAGGTATTTCTGGTGGTCGCATTCATATGTCAGTTTTAGGAAGGCTTGGGACATTTGAAACTCAGATTCTGCAAAGAGCTCCTCTTAGATCCTTTACAGAAACACCAGCATACTTTGCCTCAAAAGATGGGATAAGTAAAGATGGTTCTGGAGATGGAAATAAGAAATCAGCAAGTGAGGGAAGTAGTAAGAAATCAGGCTCTGGGAATTCTGGGAAAGGTGGAAACCAGCTGCGCTGTCCTAAATGTGGCGACTTGTGCACACATGTAGAGACCTTTGTATCATCCACCCGTTTTGTCAAGTGTGAAAAGTGTCATCATTTTTTTGTTGTGCTATCTGAAGCAGACTCAAAGAAAAGCATAATTAAAGAACCTGAATCAGCAGCAGAAGCTGTAAAATTGGCATTCCAACAGAAACCACCACCTCCCCCTAAGAAGATTTATAACTACCTCGACAAGTATGTTGTTGGCCAGTCATTTGCTAAGAAGGTGCTTTCAGTTGCTGTGTACAATCATTATAAGAGAATATATAATAATATCCCAGCTAATCTGAGACAGCAAGCAGAGGTTGAGAAGCAGACATCATTAACACCAAGAGAGTTAGAAATAAGAAGACGGGAGGATGAGTACAGATTTACAAAATTGCTTCAGATTGCTGGAATTAGCCCACATGGTAATGCTTTAGGAGCATCAATGCAGCAACAGGTAAATCAACAAATACCTCAGGAAAAACGAGGAGGTGAAGTATTGGATTCTTCTCATGATGACATAAAACTTGAAAAAAGTAATATTTTGCTGCTTGGACCAACTGGGTCAGGTAAAACTCTGCTGGCACAAACCCTAGCTAAATGCCTTGATGTCCCTTTTGCTATCTGTGACTGTACAACTTTGACTCAGGCTGGATATGTAGGCGAAGATATTGAATCTGTGATTGCAAAACTACTCCAAGATGCCAATTATAATGTGGAAAAAGCACAACAAGGAATTGTCTTTCTGGATGAAGTAGATAAGATTGGCAGTGTGCCAGGCATTCATCAATTACGGGATGTAGGTGGAGAAGGCGTTCAGCAAGGCTTATTAAAACTACTAGAAGGCACAATAGTCAATGTTCCAGAAAAGAATTCCCGAAAGCTCCGTGGAGAAACAGTTCAAGTTGATACAACAAACATCCTGTTTGTGGCATCTGGTGCTTTCAATGGTTTAGACAGAATCATCAGCAGGAGGAAAAATGAAAAGTATCTTGGATTTGGAACACCATCTAATCTGGGAAAAGGCAGAAGGGCTGCAGCTGCTGCAGACCTTGCTAATCGAAGTGGGGAATCGAATACTCACCAAGACATTGAAGAAAAAGATCGGTTATTGCGTCATGTGGAAGCCAGAGATCTGATTGAGTTTGGCATGATTCCTGAGTTTGTGGGACGGTTGCCTGTGGTGGTTCCATTGCATAGCCTAGATGAGAAAACACTTGTACAAATATTAACTGAGCCACGAAATGCTGTTATTCCTCAGTACCAGGCCTTATTCAGCATGGATAAGTGTGAACTGAATGTTACTGAGGATGCTTTGAAAGCTATAGCCAGATTGGCACTAGAACGAAAAACAGGTGCACGAGGCCTTCGGTCCATAATGGAAAAGCTGTTACTAGAACCAATGTTTGAAGTCCCTAATTCTGATATCGTATGTGTGGAGGTTGACAAAGAAGTAGTAGAAGGAAAAAAGGAACCAGGATACATCCGGGCTCCAACAAAAGAATCCTCTGAAGAGGAGTATGACTCTGGAGTTGAAGAAGAAGGATGGCCCCGCCAAGCAGATGCTGCAAACAGCTAAACTGTCATATTGCTGTCTTGTATATACAGCTTTTCCTTCTTTTGTTTAGGATCATAATTGTCTCTACAGTCTGATATTAAAGGCATTGGATCTATCTTGGATATCATACATGGTCAGAGAAGCCTTTAGGAGAAGAATCAGATCATGTATATAATTGTAACATCACATTGATTTTACGGAAGATGTTATATGGACTTTAATGACACAATGTTTAGAGATAAAATGTACATTATTTTGGTTCAGTTTTTTAAAAAAAATATGCTTTAACAAAATTCTTAGGAATTCTTTTAAGCAATGCAGGTATTGCGATAACTGTAGATTTTACAATAATGTTACTCTACAAATGGGAAAATAAATTCTTTAAAATTGAATATTGAGATACCATTCTTTAGTGTTACCTTTTTTACCCACATGTGTTTCTGAAAATATTGGAATTTTA