Transcript asmbl_20776

Sequence
Transcript Sequence for observation asmbl_20776 of TGE0032499:
GGAAGTGAAGGCAGCTTCCCGCCTCCGTCCCCGTTGCTGCCGCCATACACGCTCGCAGTGCTTAGCTCTTCTGTCGGAAACTGGTGTCTTTCCCCTTGCTGTTCTTCAACCCCTCTCTTTGGCCCTTGCTTCCTCACCTGCTCTGGGACACCTAACTCAAGAGACCTCCCTTCTCCCCCTGCCGGCCCAATTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGACTACGAAGACGACGAGGTGGAGACAGCCGCTGGGGCAGATGGGACCGAGGCTCCCGCCAAGAAAGACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCCGGCTTCCGAGATTTTCTACTCAAGCCAGAGCTGCTCCGGGCCATCGTTGACTGTGGCTTTGAGCATCCATCAGAGGTCCAGCATGAGTGCATCCCGCAGGCCATTCTGGGGATGGATGTCCTGTGCCAGGCCAAGTCAGGCATGGGAAAAACAGCAGTGTTTGTCCTGGCCACACTGCAGCAGCTGGAGCCCGTTACTGGGCAGGTGTCTGTGCTGGTGATGTGTCACACTAGGGAGCTGGCTTTTCAGATCAGCAAGGAATATGAGCGCTTCTCTAAGTACATGCCGAATGTCAAGGTGGCAGTGTTTTTTGGCGGTCTGTCTATCAAGAAGGACGAAGAGGTGCTGAAGAAGAACTGCCCACACATCGTCGTGGGGACTCCTGGCCGAATTCTAGCCCTGGCTCGAAATAAGAGCCTGAACCTCAAACACATTAAACACTTTATTTTGGACGAGTGTGACAAGATGCTTGAACAGCTCGACATGCGTCGGGATGTCCAGGAAATTTTTCGCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGAGATCCGCCCAGTCTGCCGCAAGTTCATGCAAGATCCTATGGAGATCTTCGTGGATGACGAGACCAAGTTGACGCTGCACGGGTTGCAGCAGTACTACGTGAAACTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGATCTTCTCGATGTCCTCGAGTTCAACCAGGTGGTGATCTTTGTGAAGTCCGTGCAGCGCTGCATCGCCCTGGCCCAGCTTCTAGTGGAACAGAACTTCCCAGCCATTGCTATCCATCGTGGAATGCCCCAGGAGGAGAGGCTCTCTCGGTATCAGCAGTTCAAGGATTTTCAGCGGAGGATTCTTGTGGCTACCAACCTGTTTGGCCGAGGCATGGATATTGAGCGTGTGAACATTGCTTTCAACTATGACATGCCAGAGGACTCGGACACCTACCTGCACAGGGTGGCCAGAGCGGGCCGGTTTGGCACCAAGGGCTTGGCCATCACATTTGTGTCAGATGAGAATGATGCCAAGATCCTGAATGACGTTCAGGACCGTTTCGAGGTCAACATCAGCGAGCTGCCCGATGAGATTGACATTTCCTCCTACATTGAGCAGACACGGTAGAGGACTCGCGTGGTCAGTCTGCTGTAGAAGAGGACACGGGTCAGGAGGAGACACTGCCGCCCCACCCGACACCGACGCCTCTGCCCACCCTATCTATGCTTCTCTCTGCGTCACCACCACTCCTAAACCTAGTCCTGATTTATCAGAGTTGTTTGTTTGTTTGTTTTTGTTT