Transcript asmbl_20773

Sequence
Transcript Sequence for observation asmbl_20773 of TGE0032496:
TTAGAGTGTGCGCACGCGTGGCGCCGCTCACGCAGGCGCAGTGCGGTCCCCCGGGCGACGACGGCGGCGGCGGCGGCTCCTCCGGGTGGTCGGCTCCCTCCCATCTCGGCCGGCCCGGGCCCGTCTCGCCCCCCAGAAACTCACTGTTCGGGGCTGTGGACTTTCTCATCGTGCCCCACGAAAGTAAATCGGGGGAGACTGGGGGAGCCGGAAGTACCGCCTCGAGATCCCCCCAAATACGATCGGGGAAACGGAAGTGGCCCTTGGTGCCAGGTTGGGGGAGACCGGAAGTGACGAGAGCTGTCGGCCATGGAGCCGAGTGATAGTGCCAGTACCGCTATGGAGGAGCCTGACAGCCTGGAGGTACTGGTGAAGACCCTGGACTCTCAGACTCGGACTTTTATTGTGGGGGCCCAGATGAATGTAAAGGAGTTTAAGGAACACATAGCTGCCTCTGTCAGCATCCCTTCCGAGAAACAGCGGCTCATCTACCAGGGCCGGGTCCTACAAGACGACAAGAAGCTCCAGGAGTACAACGTTGGGGGAAAGGTTATTCACCTGGTGGAACGGGCTCCTCCTCAGACTCAGCTTCCTTCTGGAGCATCTTCTGGGACAGGCTCTGCCTCAGCAACTCATGGTGGGGCACCCCTGCCTGGCACTCGGGGCCCTGGGGCTTCTGTTCATGACCGGAATGCCAACAGCTATGTCATGGTTGGAACCTTCAATCTTCCTAGTGAGCCCCGGGTCCGGCTGGTGATGGCTCAGCACATGATTAGGGATATACAGACCTTACTGTCCCGGATGGAGTGTCGAGGGGGAACCCAAGCTCAGGCCAGTCAGCCACCCCCGCAGACACCGCAGACTGTGGCCTCAGAGACGGTAGCCTTGAACTCACAAACATCAGAACCAGTCGAAAGTGAAGCTCCTCCTCGAGAGCCCATGGAGTCAGAAGAAATGGAGGAACGTCCCCCAACCCAGACTCCAGAGCTTGCGCCCTCAGGCCCAGCTCCCGCAGGCCCAGCTCCCGCAGGCCCAGCTCCCGCGCCAGAGACAAATGCACCCAACCACCCTTCCCCCGCAGAGCACGTGGAGGTGCTCCAGGAGCTTCAGCGCTTGCAGCGCCGTCTTCAGCCTTTCCTACAGCGCTACTGCGAGGTCCTGGGCGCTGCTGCCACCACAGACTACAACAACAACCATGAGGGCCGTGAGGAGGACCAGAGGTTGATCAACTTGGTTGGGGAGAGCCTGCGGCTACTGGGCAACACTTTCGTGGCATTGTCTGATCTGCGCTGCAATCTAGCCTGTGCACCCCCACGGCACCTGCACGTGGTTCGGCCTATGTCTCACTACACGACTCCCATGGTGCTCCAGCAGGCAGCCATTCCCATTCAGATCAATGTGGGGACTACTGTGACCATGACAGGCAATGGGGCTCGGCCTCCACCAGCTCCTGGTGCGGAGGCAGCAACCCCAGGTTCTGCCCAGGCCACATCCCTGCCTCCCTCTTCCACCACTGTTGATTCATCAACTGAAGGAGCTCCCCCACCAGGGCCAGCACCGCCACCAGCCTCCAGCCACCCACGGGTCATCCGGATTTCCCACCAGAGTGTGGAGCCCGTGGTCATGATGCACATGAACATTCAAGATTCTGGAGCACAGCCTGGTGGTGTGCCAAGTGCTCCCACTGGTCCACTGGGACCTCCTGGTCATGGACAGACCCTGGGCTCCACCCTCATCCAGCTGCCCTCCCTGCCCCCTGAGTTCATGCACGCCGTCGCCCACCAGATCACTCATCAGGCCATGGTGGCAGCTGTTGCCTCCGCGGCCGCAGGACAGCAGGTGCCCGGCTTCCCAACAGCACCAACTCGGGTGGTGATTGCCCGGCCAACTCCTCCACAGGCTCGGCCTTCCCATCCTGGGGGACCTCCAGTCTCTGGAGCTCTGGGCGCTGGGCTGGGTACAAACACTTCATTGGCCCAGATGGTGAGCGGCCTTGTGGGGCAACTTCTTATGCAGCCTGTTCTTGTGGCTCAGGGGACTCCAGGAATGGCTCAGGCTCAGGCCCAGGCCCAGGCTCAGGCCCAGGCCCAGGCCCAGGCTCCAGCTCCGGCTCCGGCTCCAGCTCCAGCTCCTGCCACTGCTTCAGCTAGTGCTGGTACTACCAACACAGCTACCACAGCTGGCCCTGCTCCTGGGGGTCCTGCCCAGCCTCCACCTCCTCAGCCCTCTGCAGCTGATCTTCAGTTCTCTCAGCTCCTGGGAAATCTGCTGGGGCCTGCAGGGCCAGGGGCTGGGGGGCCAGGCATGGCTTCTCCCACCATCACTGTGGCAATGCCTGGTGTCCCTGCTTTTCTCCAGGGCATGACTGATTTTTTGCAGGCATCACAGACTGCCCCTCCACCCCCTCCACCTCCTCCACCCCCACCCCCTGCCCCAGAGCAGCAGAGCACACCCCCACCAGGGTCTCCTTCTGGTGGAACAGCAAGCCCTGGAGGCTTAGGTCCTGAGAGCCTGCCACCAGAGTTTTTCACCTCAGTGGTGCAGGGCGTGTTGAGCTCCCTCCTGGGCTCCTTGGGGGCTCGAGCTGGCAGCAGTGAGAGTATCGCTGCCTTCATCCAACGCCTCAGTGGATCCAGCAACATCTTTGAGCCTGGGGCTGATGGCGCCCTTGGATTCTTCGGAGCTCTGCTCTCTCTCCTGTGCCAGAATTTCTCCATGGTGGATGTGGTGATGCTTCTCCATGGCCATTTCCAGCCACTGCAGCGGCTCCAGCCACAGCTGCGATCTTTCTTCCACCAGCACTACCTGGGTGGCCAGGAGCCCACGCCTAGCAACATCCGGATGGCGACCCACACACTGATCACTGGGCTGGAAGAGTATGTAAGGGAGAGTTTTTCTTTGGTACAGGTTCAGCCAGGTGTGGATATCATCCGGACAAATTTAGAATTTCTCCAAGAGCAGTTTAACAGCATTGCTGCTCATGTGCTGCACTGTACAGACAGTGGATTTGGAGCCCGGTTGCTGGAGCTGTGTAACCAGGGCCTGTTTGAATGCTTGGCCCTGAACCTCCACTGCTTGGGGGGACAGCAAATGGAGCTTGCTGCTGTCATCAATGGTCGAATTCGCCGCATGTCTCGCGGGGTGAATCCATCCTTGGTGAGCTGGCTGACAACCATGATGGGACTGAGGCTTCAGGTGGTCTTGGAGCACATGCCTGTGGGTCCCGACGCCATCCTCAGATATGTTCGTAGGGTTGGTGATCCTCCTCAGACACTTCCTGAAGAGCCGATGGAAGTTCAGGGAGCAGAAAGAACTTCCCCTGAACCTCAGAGAGAGAATGCTTCCCCAGCCCCTGGAACAACAGCAGAAGAAGCCATGTCCCGAGGCCCGCCCCCTGCTCCTGAAGGAGGTTCCCGAGATGAACAGGATGGAGCTTCAGCTGATGCAGAACCCTGGGCAGCTGCAGTCCCCCCTGAATGGGTCCCTATTATCCAGCAGGACATTCAGAGCCAGCGGAAGGTGAAACCTCAGCCGCCCCTGAGTGATGCCTACCTCAGTGGCATGCCTGCCAAGAGACGAAAGACAATGCAGGGTGAGGGCCCCCAGCTGCTACTCTCAGAGGCAGTGAGCCGGGCAGCTAAGGCAGCCGGAGCTCGGCCCCTGACAAGCCCCGAGAGCCTGAGCCGGGACCTGGAGGCACCAGAGGTTCAGGAGAGCTACAGGCAGCAGCTCCGGTCTGATATCCAAAAACGACTGCAGGAAGATCCCAACTACAGCCCCCAGCGCTTCCCTAATGCCCATCGGGCATTTGCTGATGACCCCTAGCTTTCTCACCAGGGGACCACTTCCCCCCTTCCTTCACAGTATTTAAGAAATAAAAGTCGGATTTTCCTGG