Transcript asmbl_20531

Sequence
Transcript Sequence for observation asmbl_20531 of TGE0032470:
CTGATAGGAGCGTCTTTCCTCGTCGCTGTTTGCGGCTTCTCTGGTCGAGTTGTGCGGAGCTTCTCGGCCGTCCCCACTGGCCACCATGTCCGCCCAGGCGCAGATGCGGGCCCTGTTGGACCAGCTCATGGGCACGGCTCGGGACGGTTCAGTGTATCTTTGCCTGCCTACATCAATCTGCAAGGGAGTTGCAGAAAAGCCTCATGTTCATCGAGCCGAGATGAAACCAGACAGAGGGTCAAGTTTACAGATGACCGTGTCTGCAAGAGTCACCTTCTGGACTGCTGCCCCCATGACATCCTTGCTGGGACGCGCATGGATTTAGGAGAATGTACCAAAATCCACGACTTGGCTCTTCGAGCAGATTATGAAATTGCAAGTAAAGAAAGAGACCTGTTTTTTGAATTAGATGCTATGGATCACTTAGAGTCCTTCATTGCAGAGTGTGATCGGAGAACCGAACTTGCCAAAAAGCGGCTGGCTGAAACACAGGAGGAAATCAGTGCAGAAGTTTCGGCTAAGGCAGAAAAGGTACATGAATTAAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTAGGAGCTGAAGGAAATGTGGACGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTTCGTGCAAAGAAAAAAGAAGCAGAGGAAGAATATAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAAAAACTCCGTGTTTGCGAGGTTTGTTCAGCTTACCTTGGTCTCCATGACAATGACCGTCGGCTTGCAGACCACTTCGGGGGCAAGTTACACCTGGGGTTCATTCAGATCCGGGAGAAGCTTGATCAGTTGAGGAAAACTGTGGCTGAAAAACAGGAAAAAAGAAATCAGGATCGATTGAGGAGAAGAGAGGAGAGAGAGCGAGAAGAGCGCCTGGGCAGGAGGTCTGGATCAAGAACCCGAGATCGCAGAAGGTCACGCTCCCGGGATCGTCGACGGAGGCGGTCTAGGTCTACCTCCAGAGAGCGGCGGAAGTTTTCCCGTTCCAGATCCCGAGATAGATACAGGCGCCATCGCAGCCGTTCCCGGAGCCACAGCCGGGGTCACCGCCGGGCTTCCAGGGACCGGAGTACAAAATACAAGTTCTCCAGGGAGCGCTCATTGAGAGAGGAATCCTGGGAGTACGGGCGGAATGAACGAGGGCCCACTGACTGGAGGCTGGAGAATTCCAATGGCAAGACTGCATCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAATCTGGCTCAGGCGCTGTAAATAGTCTGACAAATGTTCGGCACCGCCTAAATTACCCTTTATATTTGCTGATACAACTCATCTTTTGTAGTTAAAATTTCTATTGTTTGGTCCTAGCTGTGAGTTTCTAGAGTTGTTCAGAGCTGCTTCTGTGTTTGGGGTTACATTGTATAGGAACAAATAAATCTGGCGGCTGCC