Transcript asmbl_20464

Sequence
Transcript Sequence for observation asmbl_20464 of TGE0005013:
TTGGTTAAGATTGCTTTTTTGGCCGTGAGGTTGAGCAAAACTCTCTCACTCTGCATGGTTACACAAGGTTTTACCCGTGTGACTTTCGTACGGAGAGAGAGAGAAAACGAGTTCCTTCAGGACTTTGGATTGGCCTCACAGTGGCCTCTCTTGCCTAGAGGAGCACCACAGGTCCTCTTTGGGATGTGCTGGTGCCATGACCTGTCTCCAGCCATTTCACCTAAGTCTTCTCATAGGCTTTCGTCGCTATTGGGGACTACAATGGTCACGTTGGTCTTGGTGTTAAGTGCTCCAAGGAGGTTGCCACTGCCATCCGAGGGGCCATCATCTTGGCCAAGCTTTCCATCGTCCCTGTGCGGAGAGGCTACTGGGGGAACAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCTGTGCCCAAGAAGCTCCTGATGATGGCCGGTATAGATGACTGCTACACTTCAGCCAGAGGCTGCACTGCCACCCTGGGCAACTTTGCTAAGGCCACCTTTGATGCCATCTCCAAGACTTACAGCTACCTGACTCCCGACCTCTGGAAAGAGACTGTCTTCACCAAGTCTCCTTATCAGGAATTCACGGATCATCTTGTGAAAACCCACACCAGAGTCTCTGTTCAGAGGACCCAGGCTCCAGCTGTGGCTACCACATAAGGGTTTTTATATGAGAAAAATAAAAGAATTAAGTCTGCTGAT