Transcript asmbl_20439

Sequence
Transcript Sequence for observation asmbl_20439 of TGE0032465:
GCGGCGGCAGCGGTCAGCGGTCGACCATGGCAGAGGCGGAAGCCGGTGGCGACGAAGCCCGCTGCGTGCGGCTGAGCGCCGAGCGGGCCAAGTTGCTGCTGGCCGAGGTGGACACGCTGCTGTTCGACTGCGATGGCGTGCTGTGGCGCGGTGAGACGGCCGTGCCGGGCGCGCCGGAGACTCTGCGGGCTCTGCGGGCCCGCGGCAAGCGACTGGGCTTCATCACCAACAACAGCAGCAAGACTCGCACGGCCTACGCGGAGAAGCTAAGGCGCTTGGGTTTCGGCGGCCCGGTGGGGCCCGAAGCTGGCCTCGAGGTGTTCGGCACGGCCTATTGCAGCGCGCTCTATCTGCGCCAACGCCTGGCCGGCGTGCCGGACCCCAAGGCCTACGTGCTGGGCAGCCCGGCCTTAGCAGCCGAGCTGGAGGCCGTGGGTGTCACTAGCGTGGGCGTGGGCCCGGACGTGCTTCACGGCGATGGCCCCAGCGACTGGCTAGCCGTGCCGCTCGAACCCGACGTGCGCGCGGTAGTGGTGGGCTTCGACCCACACTTCAGCTACATGAAGCTCACCAAGGCCGTGCGGTACCTGCAGCAGCCCGACTGTCTGCTCGTGGGCACCAACATGGACAACCGGCTCCCGCTAGAGAACGGCCGTTTCATTGCGGGTACCGGCTGTCTGGTGCGAGCCGTGGAGATGGCCGCCCAGCGCCAGGCGGACATCATCGGGAAGCCTAGCCGCTTCATCTTCGACTGCGTGTCCCAGGAGTATGGTATCAACCCGGAGCGCACCGTCATGGTGGGAGACCGCCTGGACACAGACATCCTCCTGGGCTCCACCTGTAGCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTGAGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCCGACCTCTTGCCTGCCCTTCAAGGTTAAAGATCTAGTGTCTTTAATCTCTGGAATAAAAAAAAGAAAAAGAAAATCAGCTACCTAAATTAATAGTGGGGCTTAGAAATTGCTCTGTTAGGTGGCTGCAGGTTAACTGAAGTTAATAAGCAAAGGCAGTAGTTAATCTTGTAAGTAAACGTTGGGGGGGGTTGTTTACAGAGAATTATATTTTAAGATGCACTTTTAAGCTTGGAAGGCATTATGGGGTGGGCATAGCATGTGCCCAACATTCAGGTAACCTCAGGCCCTGTTGCTGAGACTGAAATGGGTCAAGGGTTGTGTGTCATGCTTTTTACTGAAATGTAATCAGGGATCAGGCCCTAAGGTGGGCAGAGTTAAAAAGGGCTCTTAATGACACAGAGACCAAAAACTG