Transcript asmbl_200

Sequence
Transcript Sequence for observation asmbl_200 of TGE0032451:
CGCGCGGTCGGCGGCGGCTGCGGCGGCAGGAGGGGCGGGAGGAGTCGGACCGGACCCTCCTCCCCGGCGCGCAGGGCCTCGTGGGGGGCGGGAAGGTACTGTCCCATATAAGCCTCTGCTCTTGGGGCTCAACCGCTCGCACCCGCTGCGCTGCACAGGGGGAGAAAAGGAGCCCAGGGTGTGAGCCGGACAACTTCTGGTCCTCTCCTTCCATCTCCTTACCGGCGTCCCCACCTCAGGACTTTTCCCGCAGGCTGCGAGGGGACCCACAGTTCGTGGCCACTTGCCTCCTGGGGAGGGCGACTCTCCTCCCATCCACTCAAGATGCTCAGGGGTCCGGGACCCGGGCGGCTGCTGCTGCTGGCAGTCCTGTGCCTGGGGACCTCGGTGCGCTGCACCGAAGCCGGGAAGAGCAAGAGGCAGGCTCAGCAAATCGTGCAGCCTCAATCCCCGGTGGCTGTCAGTCAGAGCAAGCCTGGCTGTTTTGACAATGGGAAGCACTATCAGATAAATCAGCAGTGGGAACGGACCTACCTAGGCAACGCCCTGGTTTGTACCTGCTATGGAGGAAGCCGGGGTTTTAACTGCGAGAGCAAGCCTGAGCCTGAAGAGACTTGCTTTGACAAATACACTGGGAACACTTACAAAGTGGGTGACACTTATGAGCGCCCTAAAGATTCCATGATCTGGGACTGTACCTGCATCGGGGCTGGGAGAGGCAGGATCAGCTGTACCATTGCAAATCGCTGCCATGAAGGGGGTCAGTCCTACAAGATTGGCGACAAGTGGAGGAGGCCACATGAGACTGGTGGCTACATGTTAGAGTGTCTGTGTCTGGGAAATGGAAAAGGGGAATGGACCTGCAAACCTATAGCTGAGAAGTGTTTTGATCATGCTGCTGGGACGTCCTACGTCGTGGGGGAGACCTGGGAAAAGCCCTACCAAGGCTGGATGATGGTGGACTGTACTTGTCTAGGCGAAGGCAATGGACGCATCACCTGTACCTCCAGAAACAGATGCAACGATCAGGACACCCGGACATCCTATAGGATTGGAGACACGTGGAGCAAGAAGGACAACCGAGGAAACCTGCTTCAGTGTGTCTGCACAGGCAATGGCAGAGGGGAGTGGAAGTGTGAGCGACATGCTCTACAAAGTGCTTCAGCCGGATCTGGCTCCTTCACTGATGTCCGAACAGCTATTTACCAACCGCAGACTCACCCCCAGCCCGCTCCCTACGGCCACTGTGTCACCGACAGTGGTGTGGTCTACTCTGTGGGAATGCAGTGGCTGAAGTCGCAAGGAAACAAGCAAATGCTGTGCACGTGCCTGGGCAATGGCGTCAGCTGCCAGGAGACAGCCGTGACCCAGACTTATGGTGGCAATTCAAACGGGGAGCCCTGTGTCCTCCCGTTCACCTACAACGGTAGGACCTTCTATTCCTGCACCACCGAAGGGCGGCAAGACGGACATCTGTGGTGTAGCACAACTTCCAATTACGAACAAGACCAGAAGTATTCCTTCTGCACAGACCATGCGGTTTTGGTTCAGACTCGAGGCGGAAATTCCAATGGTGCTCTGTGCCACTTCCCCTTCCTGTACAACAACCGGAATTACACCGACTGTACTTCTGAGGGTCGCAGGGACAACATGAAATGGTGCGGCACCACCCAGAACTACGATGCCGATCAGAAGTTTGGATTCTGCCCAATGGCTGCCCACGAGGAGATCTGCACAACCAATGAAGGGGTCATGTATCGCATTGGGGATCAGTGGGATAAGCAGCATGACCTGGGCCACATGATGAGGTGCACGTGTGTGGGGAACGGTCGTGGAGAATGGGCCTGCATCCCCTACTCCCAGCTCCGAGACCAGTGCATCGTTGATGACATTACTTACAATGTGAACGACACGTTCCACAAGCGTCACGAGGAGGGACATATGCTGAACTGTACCTGCTTTGGTCAGGGCCGGGGCAGATGGAAGTGTGACCCCATTGACCAGTGCCAAGATTCAGAGACCCGGACATTTTACCAGATTGGTGACTCCTGGGAGAAGTTTGTGCATGGTGTCCGATACCAGTGTTACTGCTACGGCCGTGGCATCGGGGAGTGGCACTGTCAACCTCTGCAGACCTACCCAGGCACAACTGGACCTGTCCAAGTAATTATCACGGAGACCCCCAGCCAGCCCAATTCCCACCCCATCCAGTGGAATGCCCCGGAGCCTTCACACATCACCAAGTACATTCTCAGATGGAGACCTAAAACCTCTACGGGTCGCTGGAAGGAAGCTACCATTCCTGGCCACCTTAACTCCTATACCATCAAAGGCCTGACCCCAGGTGTGATCTATGAGGGACAGCTCATCAGCATCCAGCAGTATGGCCACAGAGAAGTGACACGCTTCGACTTCACCACCAGCGCCAGCACCCCTGTGACCAGCAACACGGTGACCGGAGAGACTGCGCCCTACTCTCCTGTTGTGGCCACTTCTGAATCTGTAACTGAAATCACAGCCAGCAGCTTTGTGGTCTCATGGGTCTCAGCCTCCGACACCGTGTCAGGCTTCCGGGTGGAGTATGAGCTGAGCGAGGAGGGAGATGAACCACAGTACCTTGATCTCCCAAGCACGGCCACTTCCGTGAACATTCCTGACCTGCTCCCGGGCAGAAAGTACATTGTCAATGTCTATCAGATATCTGAGGAGGGAAAACAGAGCTTGATCCTGTCTACCTCACAGACTACAGCACCTGACGCTCCTCCAGACCCTACCGTGGACCAGGTTGATGATACTTCCATTGTTGTTCGGTGGAGTAGACCCCAGGCACCTATCACAGGGTATAGAATTGTCTATTCACCTTCAGTAGAAGGCAGTAGCACAGAGCTCAACCTCCCTGAAACGGCCAACTCCGTCACCCTCAGCGACCTGCAGCCCGGTGTTCAGTACAACATCACTATCTATGCTGTGGAGGAGAACCAGGAGAGCACACCCGTTTTCATCCAACAAGAGACCACTGGCACCCCAAGATCTGATAACGTCCCCCCTCCGACGGACCTACAGTTTGTGGAACTGACTGATGTGAAAGTCACCATCATGTGGACCCCTCCTGATAGTGTGGTGTCTGGATACCGTGTGGAGGTCCTGCCTGTCAGCCTGCCCGGGGAACATGGGCAGAGGCTGCCTGTCAACAGAAATACCTTTGCTGAAATCACTGGGCTGTCCCCTGGGGTCACGTACCTCTTCAAAGTCTTTGCTGTGCACCAGGGCAGGGAAAGCAATCCTCTGACGGCACAACAGACCACCAAACTCGACGCTCCCACTAACCTCCAGTTTGTCAATGAAACTGACAGAACAGTTCTGGTAACGTGGACTCCACCTCGAGCCCGTATAGCAGGCTACCGACTGACCGCGGGCCTGACCCGAGGAGGCCAGCCCAAGCAGTACAATGTGGGACCCTTGGCCTCCAAGTATCCCCTGAGAAATCTGCAGCCTGGGTCTGAGTACACCGTGACCTTGGTGGCTGTGAAAGGGAACCAGCAGAGTCCCAAAGCCACCGGAGTCTTTACTACCCTGCAGCCTCTGCGCTCCATTCCACCTTACAACACCGAGGTGACAGAGACCACAATTGTGATCACCTGGACCCCCGCTCCAAGGATTGGCTTCAAGCTGGGTGTACGACCGAGCCAGGGAGGTGAGGCACCCCGAGAAGTGACTTCAGACTCTGGGAGCATTGTTGTGTCTGGCTTGACTCCAGGCGTGGAATACACTTACACCATCCAAGTCCTGCGAGATGGCCAGGAGAGAGATGCACCGATTGTCAACAGAGTAGTGACACCGCTGTCTCCACCGACCAACTTGCATCTGGAGGCAAACCCTGACACTGGAGTGCTTACTGTCTCCTGGGAGAGGAGCACTACCCCAGATATCACTGGCTACAGAATAACTACTACCCCCACGAACGGGCAGCAGGGGACCTCTCTGGAAGAAGTGGTCCATGCTGATCAGAGTTCCTGCACTTTTGAGAACCTGAATCCTGGCCTGGAGTACAACGTCAGTGTTTACACTGTCAAAGATGACAAGGAAAGTGCCCCTATCTCTGATACCGTTGTCCCAGAGGTGCCCCAGCTCACTGACCTAAGCTTTGTTGATATAACTGATTCAAGCATCGGCCTGAGGTGGACCCCGCTAAACTCTTCCACCATTATCGGGTACCGAATCACAGTAGTTGCGGCAGGAGAAGGGATCCCTATTTTTGAAGATTTTGTGGACTCCTCAGTAGGATACTACACAGTTACAGGGCTGGAGCCTGGCATTGACTATGACATCAGCGTTATCACTCTCATTAATGGCGGAGAGAGTGCCCCTACTACACTGACACAGCAAACGGCTGTCCCTCCTCCCACGGATCTGCGATTCACCAATATCGGTCCAGACACGATGCGGGTCACTTGGGCCCCGCCTCCGTCCATCGAGCTGACCAACCTCTTGGTGCGCTACTCACCCGTGAAGAATGAAGAGGACGTTGCAGAGCTATCCATTTCACCTTCAGACAATGCCGTGGTCCTAACAAATCTCCTGCCTGGGACAGAATACTTAGTCAGTGTCTCCAGTGTCTACGAACAACATGAGAGCATCCCTCTCCGGGGAAGGCAGAAAACAGGTCTCGATTCCCCAACTGGTTTTGATTCTTCTGATATCACCGCCAACTCATTCACTGTCCACTGGGTGGCTCCTCGGGCCCCCATCACCGGCTACATCATCCGCCATCACGCCGAGCATTCTGTCGGAAGACCCAGGCAGGATCGAGTGCCGCCCTCGCGGAATTCCATCACCCTCACCAACCTTAATCCGGGCACCGAGTACGTTGTCAGCATCATTGCTGTTAATGGCAGAGAGGAGAGCCCGCCACTGATTGGCCAGCAAGCCACAGTTTCTGATATTCCGAGAGATCTGGAGGTCATTGCCTCCACCCCCACCAGCCTGCTCATCAGTTGGGAACCCCCTGCCGTCTCTGTGCGCTATTACAGAATCACCTACGGAGAGACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCCGGAAGCAAGTCCACAGCCACCATCAACAACATTAAACCAGGAGCAGACTACACCATCACCCTGTATGCTGTCACTGGCCGTGGGGACAGTCCAGCAAGCAGCAAGCCAGTTTCCATCAATTATAAAACAGAAATTGACAAGCCGTCCCAGATGCAGGTGACAGATGTCCAGGACAACAGCATCAGTGTCAGGTGGCTGCCTTCAACTTCTCCTGTGACAGGCTACAGAGTGACCACCACTCCCAAAAATGGCCTAGGACCATCAAAAACTAAAACTGCCAGTCCAGATCAAACAGAAATGACCATTGAAGGTTTGCAACCCACTGTGGAGTACGTGGTTAGTGTTTATGCTCAGAACCGGAACGGAGAAAGCCAGCCCCTGGTTCAAACTGCAGTGACCAACATTGATCGCCCTAAAGGACTGGCATTCACTGATGTGGATGTCGATTCCATCAAAATTGCTTGGGAAAGCCCACAGGGGCAAGTTTCCAGGTACAGGGTGACCTACTCGAGCCCTGAGGATGGAATCCGGGAGCTTTTCCCTGCACCTGATGGTGAAGACGACACTGCAGAGCTGCAGGGCCTCAGGCCGGGGTCTGAGTACACAGTCAGTGTGGTTGCCTTGCACGATGATATGGAGAGCCAGCCCCTGATTGGAATCCAGTCCACAGCCATTCCTGCGCCCACCAATCTGAAGTTCAGTCAGGTGACACCCACCAGCTTTACTGCCCAGTGGATAGCACCCAGTGTTCAGCTCACTGGCTACCGGGTGCGGGTGAACCCGAAAGAGAAGACAGGACCAATGAAAGAAATCAACCTTTCTCCAGACAGCTCATCGGTGATTGTGTCAGGACTCATGGTGGCCACTAAATACGAAGTCAGTGTCTATGCTCTCAAGGACACACTGACAAGCAGACCAGCCCAGGGAGTCATCACTACTCTGGAGAATGTTAGCCCTCCAAGAAGGGCCCGTGTGACGGACGCTACAGAGACCACCATCACTATTAGCTGGAGAACAAAGACAGAGACAATCACTGGCTTCCAAGTCGATGCCATCCCAGCCAATGGCCAGACCCCAGTTCAGAGGAGCATCAGCCCGGATGTTAGAAGCTACACCATTACAGGTTTACAGCCAGGCACTGACTACAAGATCCACCTGTACACTCTGAACGACAATGCCCGGAGCTCGCCCGTGATCATCGATGCCTCCACCGCCATCGACGCACCATCCAACCTGCGGTTCCTGACCACCACACCCAACTCCTTGCTGGTGTCATGGCAGGCGCCCCGTGCCAGGATTACTGGCTACATTATCAAGTATGAGAAGCCTGGATCCCCTCCCAGAGAAGTGGTCCCTCGGCCCCGCCCTGGTGTCACGGAGGCCACCATTACTGGTCTGGAGCCAGGAACCGAGTACACCATCTACGTCATTGCCCTGAAGAACAATCAGAAGAGTGAGCCCCTGATTGGGAGGAAGAAGACAGTTCAAAAGACCCCCTTCATCACCAACCCTGGGTATGACACCGAAAATGGTATTCAGCTTCCTGGCACAACCCACCAGCAACCCAGTGTTGGGCAACAAATGATCTTTGAGGAACATGGCTTTAGGCGGACAACGCCACCCACTGCGGCCACCCCCGTCAGGCTTAGGCCAAGACCATACCTGCCGAATGTAGATGAGGAGGTCCAAATCGGTCATGTTCCCAGGGGAGACGTAGACTACCACCTCTATCCTCATGTTCCGGGCCTCAATCCAAATGCCTCTACAGGACAGGAAGCTCTCTCTCAGACAACCATCTCTTGGACGCCGTTCCAGGAGAGTTCTGAGTACATCATTTCATGCCAACCAGTTGGCACCGACGAAGAGCCCTTACAGTTCCAAGTTCCTGGAACTTCTACCAGTGCGACTCTGACTGGCCTTACCAGAGGGGTCACCTACAACATCATAGTGGAGGCACTGCAGAACCAGAGGAGGCACAAGGTTCGGGAAGAGGTTGTGACTGTGGGCAACGCTGTCAGCGAAGGCCTGAACCAGCCTACAGATGACTCATGCTTTGACCCTTACACGGTTTCCCATTACGCCATTGGAGAGGAGTGGGAGCGGTTGTCTGACGCTGGCTTTAAGCTCACATGCCAGTGCTTGGGCTTTGGCAGTGGTCATTTCAGATGCGATTCATCTAAATGGTGCCATGACAACGGTGTCAACTACAAGATCGGAGAGAAGTGGGATCGGCAGGGAGAAAATGGCCAGCGGATGAGCTGCACATGCCTCGGGAATGGAAAGGGAGAATTCAAGTGTGATCCCCATGAAGCAACGTGCTATGACGATGGGAAGACCTACCATGTAGGAGAACAGTGGCAGAAAGAATATCTCGGAGCCATTTGCTCCTGCACGTGTTTCGGAGGCCAGCGGGGCTGGCGCTGTGACAACTGCCGTAGACCTGGGGCTGCTGAACCCAGTCCCGATGGCACCACCGGCCACACCTACAACCAGTATACACAGAGATACAATCAGAGAACAAACACTAACGTAAATTGCCCCATTGAGTGCTTCATGCCGCTAGATGTGCAAGCTGACAGAGACGATTCTCGAGAGTAATCTTTCCAGCCCCACCCTACAAGTGTCTCTCTACCAAGGTCAATCCACACCCCAGTGATGTTAGCAGACCCTCCATCTTTGAGTGGTCCTTTCACCCTTAAGCCTTTTGCTCTGGAGCCATGTTCTCAGCTTCAGCACAATTTACAGCTTCTCCAAGCATCGCCCCGTGGGATGTTTTGAGACTTCTCTCCTCAATGGTGACAGTTGGTCACCCTGTTCTGCTTCAGGGTTTCAGTACTGCTCAGTGTTGTTTAAGAGAATCAAAAGTTCTTATGGTTTGGTCTGGGATCAATAGGGAAACACAGGTAGCCAACTAGGAGGAAATGTACTGAATGCTAGTACCCAAGACCTTGAGCAGGAAAGTCACCCAGACACCTCTGCTTTCTTTTGCCATCTGACCTGCAGCACTGTCAGGACATGGCCTGTGGCTGTGTGTTCAAACACCCCTCCCACAGGACTCACTTTGTCCCAACAATTCAGATTGCCTAGAAATACCTTTCTCTTACCTGTTTGTTATTTATCAATTTTTCCCAGTATTTTTATACGGAAAAAATTGTATTGAAGACACTTTGTATGCAGTTGATAAGAGGAATTCAGTATAATTATGGTTGGTGATTATTTTTATAAGCACATGCCAACGCTTTACTACTGTGGAAAGACAAGTGTTTTAATAAAAAGATTTACATTCCA