Transcript asmbl_19953

Sequence
Transcript Sequence for observation asmbl_19953 of TGE0032449:
TTGTTTTATCTGGCTTTTGATGGATTCTTTGTTTGACTGAAGCTCCTTTTTCAATTTGAGGTTGTCCGCTAGCACTCTCGCAGCTTCGCTTTGGGTGTCATCGAGCAGTATCTTGAAGCTAGATAATTCAGCTTGTGCCTTCTTGCGGTGTTCAACTGCCTGGGCCAGATTTCCTTTGGTCACATCCAAATCCTTCTGGGACTCGGTGTGAACGAACTCGAGGGCCTTGACGGTCTTCTCCAGGGCGCTGATCCTCTCGAGGTACCGGATGCAGTCCTTCTGCAGTTGCTTCACTTCTTGCTGCTTTTCCCGCAGCAGCTCCTGGAGCTCCTTCGCATGGCTTTTATTGGCCGGCCCTTTCTGGGCACCTTGGATCTTCTCCATGTACTCTTTTCGGATTTCTGACTCCACCTTGGTTTTTTCCTTGACCAGCTGCTGCTTTTCTTCCTCTAATTCACTCACACATCTTTGAAGGTTCCGCATTTCCGACTCTAGTTGCTCGTTTTTTATTTGGGCATCTGTAACATCCTGGTAATAATTCCCGATGCTCCCATTAAGTTCTGCCAGTTGATTCATCAGCCTCTCCTCTAAATCGTCTTTCTCCTCTTCTGCCGTCTCCTTCAGCTTGGTAACTCTGCAGAGTTCTTCTTGGATCTGCTGATTTAGCGTGGTTCTTTTGGTGACTTCTTCCTCCAGGAGCTTTAGCTCGCTATCCTTTGCAGAGATCTGAGTCAGTAGGGCATTTTTCTCATTTTCTAAAGCCTGGCTGAGTTCCCTGTCTTTCTGTTTCTCCATCTCTAACTCAGCAATTCTTCCTTTAAGCTGATCGAGCTGCTGGAGGTAGTTCTTGATGTCATCGTGGGAGCTGAAAGTCTCACTAACACCCGGCTTGGCGCCGTCGCCCATCAGAATAGCTTCCGAATCTTCAAGCTTGGCACTGTCACTCAGAGCATCTCGTTCTTGAGACTTGCCCACCACAGCTTGTGTTACCTCTTCAATGACATCCTTTGGCTCATCAGATTTCTCAGTGGCCTCCAGGCTAGCTTGTTTCAGTACTTGGGCTTCTACCTGAAGCTTTAGATTTCGAGTCTCTTCACTCAGAGCGTCCTTCTCCGCCATTAAAGCCTCAAACTCCTTAGAAAGGGTTTTATGCTCCAATGTGATCTTTTCTAGTTCCTCCTTCAAGCTGGAGTTGGAAGAAAGAAGTGCTTCCATGCTCTCACCGGTTCCTCCTACAGGCTGCGCCTCCGCTCTAAGCCGGTCATTTTCTTCCTCTAGCTCAAGGATCTTCTGTTGCTTAGATTTTGCAAACTTTCGCATCTTCTCTTTCATCTCTTCCATTTCCTGCTCTGCATCCTGCAGCTGCTTCTCTCTCTCTCTCTTGTCCGACTCTGTGCTCCTTAACTTTGCGTACAGCTCTTGCTTCTCTTGCCGCACACTTTCCACCACGTGCTGAATCCTCTCGGCTTCGTTGCTCACGTTCTCGTACGACTGCAGAAGAACCTCGTACTCCTTCTGCAGCTCCTTGTGTTTCTCTTGCCATTCGGTGCTCTCTGCCATCTTAGAACTTCTCACGGATTCCAGCTCCTCCATCAGCTTTTCCTTGTCTTCCGTGAGGCCCCCCAGAGCTAGTTTCAGGCTTTCGCAAGAGCCACTGAGGCTCTGGTTTTCCAGTAAAAACCTGTCCATTTCTGCAATGAGCTTGTCTCTTTCTTCCTGAAGAATGGTTAACTTTCCTAGGACTGCATCTTTCTCTTGATTCTGGACAGAAACCTGGCTTTCTACATCTGCCAGAGACTTGGTCAGGCGTTCAACAGCATCTCTGGCTGAGGACAACTGCTCTTGCAGGCT