Transcript asmbl_19406

Sequence
Transcript Sequence for observation asmbl_19406 of TGE0032435:
GGGCTAGAGGCGGGTCCGGGCTGGGGACCCGGCTGGCCGCGACGCTGGCGGGGTTGGCAGGGCTGGCAGCCGCCGCCTTTGGGCACGTGCAGCGGGCGGAGATGGTGCCCAAGAGCTCGGGGGCGCGGAGCCCCTCACCTGGACGGCGGGAGGAGGACGGGGACGAGCTGGCCCGCCGCTGCAGCACCTTCATGTCCTCGCCGGTGACCGAGCTGCGGGAGCTGCGGAGGAGGCCGGAGGACATGAAGACCAAGATGGAGCTGATGATTATGGAGACCCAGGCTCAGGTGTGTCGGGCACTGGCGCAGGTAGATGGCGTTGCCGACTTCACTGTGGACCGGTGGGAGAGGAAAGAAGGAGGAGGTGGCATCACCTGTGTGCTTCAGGACGGGCGTGTGTTTGAAAAGGCCGGGGTGAGCATTTCCGTCGTTCATGGGAATCTTTCTGAGGAAGCAGCGAACCAAATGAGAGGCAGAGGCAAAACTCTGAAGACGAAAGATAGTAAATTGCCATTTACTGCTATGGGTGTAAGTTCTGTGATTCACCCCAAGAATCCTTATGCGCCCACCATGCATTTCAACTACAGATACTTTGAAGTAGAGGAAGCTGACGGTAACACACACTGGTGGTTTGGGGGTGGCTGTGACCTCACACCGACATACTTGAACCAAGAGGATGCTGTCCATTTCCACCGTACTCTAAAGGAAGCTTGCGATCAGCATGGGCCAGACATCTACCCAAAGTTTAAAAAATGGTGTGACGACTACTTCTTTATAGTTCACCGCGGGGAGCGGAGGGGCATCGGCGGCATCTTTTTTGACGATCTTGACTCCCCCTCCAAGGAGGAGGCTTTCCGCTTCGTGAAGACGTGTGCTGAGGCTGTGGTCCCTTCCTATGTTCCCATTGTGAAGAAGCACTGCGATGACTCCTACACCCCCAGGGACAAGCTGTGGCAGCAGCTGAGGAGAGGGCGGTATGTGGAGTTTAATCTGTTGTATGATCGGGGCACCAAGTTTGGCCTCTTTACTCCAGGATCCAGGATCGAAAGTATCTTGATGTCTTTACCTCTAACAGCAAGATGGGAGTACATGCATTCTCCCCCAGAGAATTCCAAAGAAGCTGAAATTCTGGAAGTGTTGCGCCATCCAAAGGACTGGGTGCACTGATGCATCAGACAGAGCCTTGCTCCAGGGCCTGGTGGACACAGGTGGTGTCTTCGTGCACTGTGGCCACTGTGTGGCAGGCAGTGTCTTCCGTGCCTTACTGTCCCCGCCTTCTTCACCCTGGGCACCCCGTCTGTGGCAGGCGGTTTTGATCTTTTCCAGTGCTGTGGGAGGAGGTGGCTCAGAGGTGGGTGGGGATGTCAAACTGTCAGATTCCTTGTCTGTGACATCCATTTGTACTTTTAGAATAATTTTCTGTGACCAGTCAGTTTGACATTGTGTTTCCAGGTCTTTGAGATAAGGGAATGTAAATACTATGATAGGTACCAGGAAACTCTTCATTTTATATGTTGCTTGAAGTTTTAGTTTTTGCTACAGAAGTTTATCAGGGAATACATTTTATCTTCATTAGTTCAGTCAGGATGCCCTTCTTGGGAACTTTGGAATGCAATTTGAAGCCAGTCCGTGGTGATGTTTGCCTTTAATCTCAGTATTCAGGAAGCAGAGGCTGGTGGATCTCTGTGATTTTGAGGCCAGGCTATTCTACAAAGGGAGTTCTAGTCCAGCCAGGGCTACACAGAGAAACC