Transcript asmbl_19333

Sequence
Transcript Sequence for observation asmbl_19333 of TGE0032425:
AGCCTGCAAGAGCAGTTGTCCTCAGCCAGAGATGCTGTTGAACGCCTGACCAAGTCTCTGGCAGATGTAGAAAGCCAGGTTTCTGTCCAGAATCAAGAGAAAGATGCAGTCCTAGGAAAGTTAACCATTCTTCAGGAAGAAAGAGACAAGCTCATTGCAGAAATGGACAGGTTTTTACTGGAAAACCAGAGCCTCAGTGGCTCTTGCGAAAGCCTGAAACTAGCTCTGGGGGGCCTCACGGAAGACAAGGAAAAGCTGATGGAGGAGCTGGAATCCGTGAGAAGTTCTAAGATGGCAGAGAGCACCGAATGGCAAGAGAAACACAAGGAGCTGCAGAAGGAGTACGAGGTTCTTCTGCAGTCGTACGAGAACGTGAGCAACGAAGCCGAGAGGATTCAGCACGTGGTGGAAAGTGTGCGGCAAGAGAAGCAAGAGCTGTACGCAAAGTTAAGGAGCACAGAGTCGGACAAGAGAGAGAGAGAGAAGCAGCTGCAGGATGCAGAGCAGGAAATGGAAGAGATGAAAGAGAAGATGCGAAAGTTTGCAAAATCTAAGCAACAGAAGATCCTTGAGCTAGAGGAAGAAAATGACCGGCTTAGAGCGGAGGCGCAGCCTGTAGGAGGAACCGGTGAGAGCATGGAAGCACTTCTTTCTTCCAACTCCAGCTTGAAGGAGGAACTAGAAAAGATCACATTGGAGCATAAAACCCTTTCTAAGGAGTTTGAGGCTTTAATGGCGGAGAAGGACGCTCTGAGTGAAGAGACTCGAAATCTAAAGCTTCAGGTAGAAGCCCAAGTACTGAAACAAGCTAGCCTGGAGGCCACTGAGAAATCTGATGAGCCAAAGGATGTCATTGAAGAGGTAACACAAGCTGTGGTGGGCAAGTCTCAAGAACGAGATGCTCTGAGTGACAGTGCCAAGCTTGAAGATTCGGAAGCTATTCTGATGGGCGACGGCGCCAAGCCGGGTGTTAGTGAGACTTTCAGCTCCCACGATGACATCAAGAACTACCTCCAGCAGCTCGATCAGCTTAAAGGAAGAATTGCTGAGTTAGAGATGGAGAAACAGAAAGACAGGGAACTCAGCCAGGCTTTAGAAAATGAGAAAAATGCCCTACTGACTCAGATCTCTGCAAAGGATAGCGAGCTAAAGCTCCTGGAGGAAGAAGTCACCAAAAGAACCACGCTAAATCAGCAGATCCAAGAAGAACTCTGCAGAGTTACCAAGCTGAAGGAGACGGCAGAAGAGGAGAAAGACGATTTAGAGGAGAGGCTGATGAATCAACTGGCAGAACTTAATGGGAGCATCGGGAATTATTACCAGGATGTTACAGATGCCCAAATAAAAAACGAGCAACTAGAGTCGGAAATGCGGAACCTTCAAAGATGTGTGAGTGAATTAGAGGAAGAAAAGCAGCAGCTGGTCAAGGAAAAAACCAAGGTGGAGTCAGAAATCCGAAAAGAGTACATGGAGAAGATCCAAGGTGCCCAGAAAGGGCCGGCCAATAAAAGCCATGCGAAGGAGCTCCAGGAGCTGCTGCGGGAAAAGCAGCAAGAAGTGAAGCAACTGCAGAAGGACTGCATCCGGTACCTCGAGAGGATCAGCGCCCTGGAGAAGACCGTCAAGGCCCTCGAGTTCGTTCACACCGAGTCCCAGAAGGATTTGGATGTGACCAAAGGAAATCTGGCCCAGGCAGTTGAACACCGCAAGAAGGCACAAGCTGAATTATCTAGCTTCAAGATACTGCTCGATGACACCCAAAGCGAAGCTGCGAGAGTGCTAGCGGACAACCTCAAATTGAAAAAGGAGCTTCAGTCAAACAAAGAATCCATCAAAAGCCAGATAAAACAAAAAGATGAAGACCTCTTGCGAAGACTGGAGCAAGCAGAGGAGAAACACCGGAAAGAGAAGAAGAACATGCAAGAGAAGCTGGATGCCTTGCACAGAGAGAAGGCCCACGTGGAAGAAACGCTTGCAGAGATTCAAGTCAGTCTGACCAGGAAAGACCAGGAGATGAAGGAGCTGCAGGGAAGCCTGGATAGCACCTTGGCCCAGCTTGCAGCCTTCACTAAGAGCATGTCATCCCTGCAGGATGACCGGGACAGGGTGATCGATGAAGCTAAGAAATGGGAGCGGAGGTTTGGCGATGCCATTCAAACCAAAGAGGAAGAGGTCAGACTCAAAGAGGAGAACTGCATTGCTCTAAAGGATCAGCTCCGACAGATGGCCATCCACATGGAGGAATTGAAGATCACCGTCTCCAGGCTTGAACATGACAAGGAAATCTGGGAGTCCAAGGCCCAGACGGAGCTCCAGCATCACCAGAAGGCTTATGATAAGCTGCAAGAGGAAAATAAAGAACTTACGTCTCAGTTAGAAGACGCTCGCCAGCTGTATCATGATTCTAAGAATGAATTAACTAAGTTAGAATCAGAACTTAAGAGTCTCAAAGACCAGACAACTGACCTAAATAACTCTTTAGAAAAATGCAAAGAACACGAAAACAACTTGGAAGGGATCATAAAGCAGCAAGAAGCTGATATCCAAAATTGTAAGTTCAGTTGTGAACAGCTAGAGACTGACCTAGCGGCCTCCAGAGAACTCACCAGTCGGCTGCACGACGAAATCAATGCGAAGGAACAGAAGATCATAAGCCTGCTTTCTGGCAAAGAAGAGGCGATCCAACTAGCTGTTGAGGAACTGCACCAGCAACACAGTAAAGAGATCAAAGAACTAGAAAACCTGTTGTCCCAGGAGGAAGAGGAGAATGTGGCCTTAGAAGAGGAAAACAAAAGGGCCCTTGAGAAAACCAATCAGCTCACAGAAGCATTGGAAGCCATCAAGAAGGAGAGCTTTGAGCAGAAGGCTCAGTTGGACTCCTTTGTGAAGTCTATGTCCTCTCTCCAGGATGACCGGGACCGCATCGTAAGTGACTATCGGCAGCTGGAAGAGCGACATCTCTCTGCAATCTTGGAAAAAGACCAGCTCATCCAAGATGCTGCTGCTGAGAATAATAAACTGAAGGAGGAGATGCGAGGGTTGCGAAGTCACATGGATGATCTCAATTCTGAGAATGCCAAGCTGGATGCGGAGCTGGTCCAGTATAGGCGGGACCTGAACGAGGTGATAGCCATAAAGGACTCTCAGCAAAAGCAGCTCCTTGATGCTCAGCTACAGCAGAATAAAGAGCTGAGAAATGAGTGTACAAAGCTAGAGGAAAGGCTGAAAGGGTTAGAAGCAGAGAAGCAAAGCCTACAAATGTCCTCCGATGCCCTCCAGAAGGAGAAACAAGGTTTGTCTAAAGAGATCAAAAACTTACAGACACAGTTGACCGCCCTGCAGGAAGAAGGAACGCTAGGTGTCTACCATGCCCAACTGAAAGCAAAAGAAGAAGAGCTCCAGAGGCTAAATATGGCTCTCTCCTCCTCCCAGAAGAGAACTGCAGATCTGGAAGAGGAGTTAGTTTGTGTACAGAAGGAAGCTACCAGGAAGGTAAGTGAAATTGAAGATCAGCTGAAGAAAGAGCTGAAGCACCTCCATCACGACGCAGGGATAATGCGAAACGAGACAGAAACAGCCGAAGAGAGGGTGGCAGAGCTGGCGAGAGACCTGGTTGAGATGGAACAGAAGTTGCTTACGGTAACCAAAGAGAATAAGGATCTTATGGCGCAGATTCAGGCCTTTGGAAGGTCAATGAGCTCCTTGCAGGACAGCAGAGATCATGCCACTGAGGAGCTTGGTGACCTGAAAAAGAAGTATGATGCCAGTCTCAAGGAGCTGGCCCAGCTGAAAGAGTGGCAGGACTCAAGCAGAGAGGGGGACGTTCTTTCCCAGGCTGCCTTTCCCCTGTCCACCTCTGAGAACGTCTTGTCCCGCCTTGAGAAACTGAACCAGCAGCTCACATCCAAAGACGAGCAGTTGCTTCACCTATCTTCAGAACTAGAAAGTTCTCACAACCAAGTGCAGTCCATCTCCAAAGCCATGACCAGTCTACAGAATGAGAGAGATCGCCTATGGAGTGAGCTGGAGAAATTCCGGAAGTCTGAGGAAGGGAAGCAGAGGGCTGCAGCCCCTTCAGCTGCCTCCAGCCCAGCAGAAGTACAGAGCTTGAAAAAAGCCATGTCTTCACTCCAGAATGACAGAGATCGATTGCTGAAGGAACTGAAGAATCTGCAGCAGCAGTACTTACAGATGAGCCAAGAGATGACCGAGCTCCGTCCGCTGAAGGCTCAGCTCCAAGAATCTCAAGATCAGACAAAGGCACTACAGGTGATGGAGGAGGAGCTCAGGCAGGAAAACCTCTCCTGGCAACACGAGCTGCGTCAGCTCAGGATGGAGAAGAATTCCTGGGAGCTGCATGAGAGGAGGATGAAGGAACAGTTCCTCATGGCCATCTCAGATAAAGATCAG