Transcript asmbl_18109

Sequence
Transcript Sequence for observation asmbl_18109 of TGE0000486:
CTCTACTAAAAATACAAAAATTAGCTGGGCATGGTGGTGCACGCCTGTAATCCCAGCTACTCGGGAGGCTGAGCGGGAGTCTCGCGCCAGCTGAGCGGCGGTCGGGCGGGGGGAGCGCGGCGGCCCAAGCTCGCTCGGCCACGCGCCCCGCCCCCTCAGAGGCCGGCCTCCCGCACGCACCGCGCAGCCTGCTGTGCCCGTGGGTCCCGAGTGCTCCGCCGCCCGCCCCGACCCGGGCCCAGCCGCCTCCACGGCCCGCGCTCGTACTGGAGCGAAGAGCGGCCTCCTGAAGGAGGGGAAGGGACGTGGGGGCGGCCACGGCAGGATTAACCTCCATTTCAGCTAATCATGGGAGAGATTAAAGTCTCTCCTGATTATAACTGGTTTAGAGGTACAGTTCCCCTTAAAAAGATTATTGTGGATGATGATGACAGTAAGATATGGTCGCTCTATGACGCGGGCCCCCGAAGTATCAGGTGTCCTCTCATATTCCTGCCCCCTGTCAGTGGAACTGCAGATGTCTTTTTCCGGCAGATTTTGGCTCTGACTGGATGGGGTTACCGGGTTATCGCTTTGCAGTATCCAGTTTATTGGGACCATCTCGAGTTCTGTGATGGATTCAGAAAACTTTTAGACCATTTACAATTGGATAAAGTTCATCTTTTTGGCGCTTCTTTGGGAGGCTTTTTGGCCCAGAAATTTGCTGAATACACTCACAAATCTCCTAGAGTCCATTCCCTAATCCTCTGCAATTCCTTCAGTGACACCTCTATCTTCAACCAAACTTGGACTGCAAACAGCTTTTGGCTGATGCCTGCATTTATGCTCAAAAAAATAGTTCTTGGAAATTTTTCATCTGGCCCGGTGGACCCTATGATGGCTGATGCCATTGATTTCATGGTAGACAGGCTAGAAAGTTTGGGTCAGAGTGAACTGGCTTCAAGACTTACCTTGAATTGTCAAAATTCTTATGTGGAACCTCATAAAATTCGGGACATACCTGTAACTATTATGGATGTGTTTGATCAGAGTGCGCTTTCAACTGAAGCTAAAGAAGAAATGTACAAGCTGTATCCTAATGCCCGAAGAGCTCATCTGAAAACAGGAGGCAATTTCCCATACCTGTGCAGAAGTGCAGAGGTCAATCTTTATGTACAGATACATTTGCTGCAATTCCATGGAACCAAATACGCGGCCATTGACCCATCAATGGTCAGTGCCGAGGAGCTTGAGGTGCAGAAAGGCAGCCTTGGCATCAGCCAGGAGGAGCAGTAGTGTGTCTCTCGCTGTCAATGATGAGTTGACCCGGTGTGTTCTTGTATAGTCAGTGGCATCAGCACCCGTCAGCCAGCCTTTTCCTTCAGGTTCGTCAGGCTCACCGGTTCTCACTGTGTCTGGGAAGTAGGACTGATGGTCATCTTCATGACAGGCGGCATCTCCACTAAGCCTGTGTAACTGTTCCCTCTTTGGTTTTCTTAGCTTTTGAATTTGAAGAAGTACTTTTGAAGACTCCCATTTTAAGAACCGTGCAAATTTTGCTACCAAAAGTCTTCACCACTGTGTTCTTAAGTGAATGTTAATTTCTGAGGTTTGGGACTTTGTGGTGGTTTTTTTCTTCTTTTCTTTTCCATTCTTCTTTCTTTCTTTTTATGTTGTTTGCTGTAAATGCTGCACATCCAGATTGCATATCAGGACATTGGTTATTTTATGCTTTCTTGGATATAACCATGATCAGAGTGCCATGGCCACTACCCCACTGTTTGCTCTCCTGCAAATCAACTGCTTTTAATTTACACTTAAACAAATTGTTTTGAGTGTTAGCTACTGCCTTTCTAGATATTAGTCATTTGGAATAAAAATTCAATTTAAC