Transcript asmbl_19235

Sequence
Transcript Sequence for observation asmbl_19235 of TGE0007602:
CGCTGAGTGGGTTTTCGGATCATGTCTGGTGGCTCCGCGGATTACAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTTA