Transcript asmbl_19232

Sequence
Transcript Sequence for observation asmbl_19232 of TGE0031446:
GGGAAAGTGACCTTTGGGGAAGTACTAGCACCTGATTGTATTCCTTAAAGTGAAATGATGGCAAATCATCTTTCGGGACTGACCTGAAATGAAGAGAATACTCTTGCTGATCACTTATGTGGGCGTAACTTTATGTTCCAACTGGAATACATGGTGTATAGTAGAAGTAACGATTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGATTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCCAAGGCATTTTGTATGTTAGCATTTCTGATAGGGAGTGATAGGTGGTTTGTATTGTCTGGTACTTTGTAGGAAGGTAGAGAGCTGTTTTGGAGGTAACACGTTTGAGTAATTTGAGTATATAACGTGTGAAAAGAAGCTGAGCAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATACTTGCTTTCACACTGGAAAAAAAGTAAGTTTTAGAAAATAGTTAACCTTGCAGCATTTGTATTTACAGTTCCAGAAGTGCGTCGAAATGGATTGTATAACTGTTTTCTTTTATTCCTGGTGTTTACATTTGTCCCAGGCTGACAACTGCTCCTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACCCCAAACACAATACTGTCATCTGCTTTATTGTAATGCTCAAGGCGCCTATCTCATTTTGCAGCCAGACAAGCCTTGAATTCTTTTGGTGGCACTATCTGCAAAGGAAGATGTTTTTCCACCTGGATATTGGTTTTATCAGCTAGTGCTCCACTTAAAAGCACGAACTATAATCCTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCGTCATATTCAGTAGCTTTAAATAGTACTAAAGTAACTTGCTGACTGTTGGTTTCTTTCTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTTA