Transcript asmbl_19208

Sequence
Transcript Sequence for observation asmbl_19208 of TGE0007598:
CGAGCACCTCGGAGGTGGCCCTTCCCGGCGGAAGTGAAGAAGCCCCGAGAAGGAGGCAGCGGAAGTGGCTGCGTGACTGCAGCCCGTGCGCACGCGCCCTCGGCCTCGTTGCCGCTTTTGGGGCGGTACTCTGCCCTGTCTTACTTTTCTCCACGTGAGGGGGTGCGCGAATCCCCAGTGGTGGCCGCGCGCTCACATCCTCTGCAGCTTTCGTGCCCTTCGCGATGGCGGGCATCCTGTTCGAGGATATTTTCGATGTGAAAGACATCGACCCAGAAGGCAAGAAATTTGACCGAGTATCCCGGCTGCACTGTGAGAGTGAATCTTTCAAGATGGACCTCATCTTAGATGTAAACATTCAGATTTACCCTGTGGACTTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACAACCCCACAGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGATGAGACCTCCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGCCAACAACCTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAACCAGACTTGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGGGGCGGAACTCTGTCCACTGTGGGGACGTCTTCAGTTTGTCTGAATGCAGTGGAAAACCGACTCTCCCTCTCGGAAGGCCGAGAGGGAGAACTTAGCATGAACCTGAAGTTGT