Transcript asmbl_19202

Sequence
Transcript Sequence for observation asmbl_19202 of TGE0032408:
CGAGCAGGTGCGCGCGCAGCAGGCCGGCAGTAGTGGCGGAGATGGAGGAGGGTGGACGAGACAAGACACCCGTGCAGTCCCAACAGCCCTCCGCGACAACCCCCAGCGGCGCGGACGAGAAGTCGAGTGGCAAGGAGCGAAGGGATGCCGGGGAAAAAGACAAAGAGCAGGAGCTGTCTGAGGAGGACAAACAGCTTCAAGATGAACTGGAGATGCTCGTGGAGCGACTCGGGGAGAAAGATACATCTCTATATCGACCAGCTCTGGAGGAACTGAGAAGACAAATTCGTTCTTCTACAACTTCCATGACTTCAGTACCCAAGCCTCTCAAATTTCTGCGTCCACACTATGGCAAATTGAAGGAAATCTATGAGAACATGGCCCCTGGGGAGAATAAGTGTTTTGCAGCTGACATCATCTCTGTTTTGGCCATGACCATGAGTGGTGAGCGGGAGTGCCTCAAGTATCGGCTCGTGGGCTCCCAGGAAGAACTGGCGTCATGGGGCCATGAATACGTCAGACATCTGGCAGGAGAGGTGGCCAAGGAGTGGCAGGAGCTGGATGATGCAGAGAAAGCACAGCGGGAACCACTGCTTACCTTGGTAAAGGAAATCGTCCCCTACAACATGGCTCACAATGCAGAGCACGAGGCTTGTGACCTGCTCATGGAAATTGAGCAGGTGGACATGCTAGAGAAGGACATTGATGAGAACGCCTACGCCAAGGTCTGCCTCTATCTCACCAGTTGTGTGAATTATGTACCAGAACCTGAGAACTCTGCCCTCCTGCGCTGCGCCTTGGGCGTGTTCCGAAAGTTTAGCCGTTTCCCTGAAGCTCTGAGATTGGCACTGATGCTCAATGACATGGAACTGGTAGAAGACATTTTCACTTCCTGCAAAGATGTGGTGGTCCAGAAGCAGATGGCATTCATGCTGGGTCGGCATGGAGTGTTCCTGGAGCTGAGTGAAGATGTAGAGGAATATGAAGACCTCACAGAAATCATGTCCAATGTCCAGCTCAACAGCAACTTCTTGGCTTTAGCTCGGGAGCTGGACATCATGGAGCCCAAGGTGCCTGATGACATCTACAAAACCCACCTAGAGAATAACAGGTTTGGTGGCAGTGGCTCTCAAGTGGATTCTGCACGAATGAACCTAGCCTCCTCTTTTGTAAATGGCTTTGTGAATGCAGCCTTTGGTCAAGATAAACTACTGACTGATGATGGCAACAAATGGCTTTACAAGAACAAGGACCATGGGATGCTAAGTGCTGCTGCGTCTCTTGGCATGATTCTGCTGTGGGATGTGGATGGTGGCCTCACCCAGATTGACAAGTATCTGTACTCCTCTGAGGACTACATCAAGTCAGGAGCTCTCCTTGCCTGTGGTATCGTGAATTCTGGAGTCCGGAATGAGTGTGATCCTGCCCTGGCACTGCTTTCAGACTATGTTCTCCATAACAGCAATACCATGAGACTTGGCTCCATCTTTGGGCTAGGTTTGGCCTATGCTGGCTCTAATCGGGAAGATGTTCTAACACTGCTGCTACCTGTAATGGGAGATTCCAAGTCCAGCATGGAGGTGGCAGGTGTGACGGCTCTAGCTTGTGGGATGATAGCAGTGGGGTCCTGCAATGGAGATGTCACTTCCACCATCCTTCAGACCATCATGGAGAAATCTGAGACTGAGCTCAAGGATACCTATGCTCGTTGGCTTCCTCTTGGCCTGGGCCTCAATCACTTGGGGAAAGGCGAAGCTATTGAGGCCATCCTGGCTGCCTTGGAGGTGGTGTCAGAGCCATTCCGCAGTTTTGCCAATACCCTGGTGGATGTATGTGCCTATGCAGGCTCTGGGAATGTGCTGAAGGTTCAGCAGCTCCTCCACATCTGTAGTGAGCACTTTGACTCTAAGGAAAAGGAGGAAGACAAAGACAAGAAGGAAAAGAAGGACAAGGACAAGAAGGAAGCCCCTGCTGACATGGGAGCACATCAGGGAGTAGCTGTTCTGGGCATTGCACTTATTGCTATGGGGGAAGAGATTGGTGCAGAGATGGCATTGCGAACTTTTGGTCACTTGCTGAGATATGGGGAGCCTACCCTCCGTCGCGCTGTACCTTTAGCACTGGCACTAATTTCTGTTTCAAATCCACGACTCAACATCCTGGATACGCTAAGCAAATTCTCTCATGATGCTGATCCAGAAGTTTCCTATAACTCCATCTTTGCTATGGGCATGGTGGGCAGTGGTACCAATAATGCCCGTCTGGCTGCAATGTTGCGCCAGTTAGCTCAATATCATGCCAAGGACCCCAATAACCTCTTCATGGTGCGCTTGGCACAGGGCTTGACACATTTAGGGAAGGGCACACTTACCCTCTGCCCCTATCACAGTGATCGGCAGCTCATGAGTCAAGTAGCGGTGGCAGGGCTACTCACGGTGCTTGTTTCTTTCCTGGATGTTCGAAACATCATCCTAGGCAAGTCTCACTATGTCCTGTATGGGCTGGTAGCCGCCATGCAGCCTCGGATGCTGGTTACATTTGATGAGGAGCTGCGACCATTGCCAGTTTCTGTCCGTGTGGGTCAGGCAGTGGATGTGGTGGGCCAGGCTGGGAAGCCAAAAACAATCACAGGGTTCCAGACTCATACAACGCCAGTGTTGCTGGCCCATGGGGAGCGGGCAGAGTTGGCCACTGAGGAGTTTCTTCCTGTCACCCCCATTCTGGAAGGCTTTGTTATTCTTCGGAAGAACCCCAACTATGATCTTTGAAAAAGTGGCTTCTAGAGACCCTGGCTGCAGCGGAATTTTTTGTTTTTAGCAGGCTGTCCTGCCTGCTATGAGGGGTGGATACTGTTCCAGATCTTTGGGGGAATTGTTACCTCCTGTTGTTTTGTTACTGAGTAAGATAACTTTGTTGAATAAAGACCTTTATCCCCAAG