Transcript asmbl_18934

Sequence
Transcript Sequence for observation asmbl_18934 of TGE0032383:
ACCAAGACTGTGACAGGTTTGAAAGGGAGGGTGTGGCTTGTTTTCCAGGGGACCGTGCTGATTAAGACTGCCGAGGAGCTAATGAACTTCAGTAAGGGAGAGGAGAACCTCATGGATGCTCAGGTGAAGGCCATTGCAGGCACTGGTGCAAATGTCATAGTAACAGGCGGCAAAGTGGCGGACATAGCTCTTCATTATGCTAACAAGTACAATATCATGTTGGTGAGACTGAACTCAAAGTGGGATCTCAGACGACTCTGTAAAACAGTTGGTGCCACAGCTCTTCCAAAATTGACTCCTCCCGTCCAAGAAGAAATGGGACATTGTGACAGTGTTTACCTCTCAGAAGTTGGAGATACACAAGTGGTTGTTTTTAAGCATGAAAAAGAAGATGGTGCCATTTCTACTATAGTTCTTCGAGGTTCTACAGACAATCTGATGGATGACATAGAAAGGGCAGTAGATGATGGAGTTAATACTTTCAAAGTTCTCACAAGGGATAAGCGTCTTGTACCTGGAGGTGGAGCTACCGAAATTGAATTGGCTAAACAAATCACATCATATGGAGAGACGTGTCCTGGGCTTGAACAGTATGCTATTAAGAAGTTTGCTGAAGCGTTTGAAGCGATTCCACGGGCACTGGCAGAAAATTCTGGCGTGAAGGCCAATGAAGTTATCTCTAAACTTTATTCCGTACACCAAGAAGGAAACAAAAATGTGGGGTTGGATATCGAGGCTGAAGTCCCTGCTGTAAAGGATATGTTAGAAGCCAGTATTTTAGATACTTACTTGGGAAAATACTGGGCTATTAAACTGGCCACTAATGCTGCAGTCACTGTACTAAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGGCCCAAACCTCCAAGTGGGAAGAAGGACTGGGATGACGACCAGAATGACTGAGGAACTTGTCATAGGTTAAGAGTTGTGTTTGTAGAGTAGAACTTGCCCAGTGTTTTATTTTTCTTATTTGTGTTTGTACTCTGCTGGGTGGTACAATAAATGTGTTACTGTTATGGCCGTCTGTTTAATCACTCACATGACTGTTCTCATTGTATACTTGACCATATCTATTGGGAAAGACACTTTCTAGTCTGTTGTTTATCTCATTTCCAAAGTTGTTCCCCCAATCCCATGGCCTTGAAAGTCTGGCTTCTAAATGTTTGTTGTTTATCCCATAGCAAACAAAAAAAGTTCAGACAGTGTCCTAATTAATATAAGGCTTTTCAATAGTGGCTGGGCCAGAGTTTATGCGCACACACTGACACCAAGATTTCACATTGCTCCCAATCCTAATCTCAGCACTAGAATAGTGAAACATGGTGTTGCCAGTAGTGGGTACAGTAAATAACAACTTAAACTCTAATAAAACAAGTTTTGGGAATATCAGTTTATTGATGTGTCAAGCACTACCACCCAGTCAGAGTAAGCACAGAACTTAGTTATTCAAATCCTTCCTAAAGTTGAAACTAGAAGGAATAAAAACCAGTATGCTAATACAAAACCGCTGTAAATTATTTTGCCTGTATTTAAATAAATAAACATGATTTTTTTTCTGTCATTTACTTAGGTGAACATAATTTATAGTTTAACTTTTTATTGTTATAATAGCCAGTATAAAAGCCATAGGTGTATTTCCAGAGAAAGCACTTTTTGTTATCACAGTATT