Transcript asmbl_18886

Sequence
Transcript Sequence for observation asmbl_18886 of TGE0032373:
GGTGCAGTGCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCCGCCGGCCGCAGTCTGGGTACCTGCGGAGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCGCTGGCTTTCCAGGATGCGGGGCGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTGCTGTAGGAGTCGTTAGGCACGGCGCTACCTGAAGCGGAAGCCGCGTTCACCCAGATCGTCTCCTGTGTCGCGCTTTAAAGTGGTTCCTCACATTTCTTCAAAATGAATGTGACTGTCCGTTTCTTAAGACCTTTTGCCAGATGTCTGGTGCCATATACCTTTCATAGGAAGAGAAGTCATTTATATTCAGGAGTTCTGCAGAGATACATGTCCTCCAAAGCACCTTCTTTGTCTTGTCATAATAAGGACAGTGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCATTCAAGAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAGAGAACTAATTGAGATGTGGAGATTGCTTGGCAAAGAAGTACCAGAACATATTACTGAAGAAGATCTCAAAACCCTTATGGAATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGGTTGGAAGGGTGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACATGAAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAGAAGAAATGTTGATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCATAGAGAATTAGTTAAACGTTATAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGAAAAGTCTCCTGTTGATTTATTTCCAAAGGACAGTATTATATATTTAACTGCAGATTCTCCCAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAATTGGATCATTTGTTGATAAAAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGCAACAGAGTGCCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCAGATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTTTGTTCCCAGGAGAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGTTAGGAAACTGAAGAAGACAAAGACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCGCACGTGGAAAAGGTGACCTAAGTGAGAAAGTATGGTGAAAGAAGAAAACAGGCTGAAAGTATGGTGACAAGAATGTAGTTATTCCTAAATGGAATTATCTCTTAAAGTCAGTCTCTCTAGACTAACAGTAGAGGTTTGCCTATTTTTTCTTCTTCTTTGCTTTTTTGCAACAGGATTTCCATGTAGCCTTGTCCTCCATCAAGGCCAGACTAGACGTATGTATCAGCAAAACTTTGAAAG