Transcript asmbl_29737

Sequence
Transcript Sequence for observation asmbl_29737 of TGE0004758:
GGCGGCCGCCGCTGCGCCACGCGCGTGGCTGGCCCTGCAGCCGGCGGCCAGGACCCTCCGTGCCTTCTCCAGCGCCGTTTCTCCGGCCACTGTTGCCCAGAGTTCAAGACCGCATACAACAGAAAGAACGTCCAAATCTCAAAGGCCACTGAAAAGAAAGGCACTACCTCCTAGGACAGAGAAAATGGCTGTTGACCAAGATTGGCCTAGTGTTTACCCTGTTGCAGCACCATTTAAACCCTCTGTAGTACCTCTTCCTGTTCGGATGGGTTATCCGGTAAAGAGGGGGGTGCCCATGGCAAAGGAGGGAAATCTGGAACTTTTAAAGATCCCCAATTTTCTGCATTTGACTCCTGTAGCAATTAAAAAGCACTGTGAAGCTCTTAGAGATTTTTGCACTGAGTGGCCAGCTGCACTAGACAGTGATGAGAAATGCGAGAAGCATTTTCCAATTGAGATTGACACAGCTGATTATGTTTCATCAGGACCATCTATTCGAAACCCCAAAGCACGAGTAGTCACCTTAAGGGTTAAACTTTCCAGTTTGAATTTAGATGATCATGCAAAGAAGAAACTTATTAAACTTGTAGGAGAGCGATACTGCAAGACCACAGATGTGCTTACTATCAAGACAGATAGGTGCCCTCTAAAGAGACAGAATTATGATTATGCAATGTATCTGCTAACAGTTTTATACCATGAGTCTTGGAAAACTGAAGAGTGGGAGAAAAATAAGACCGAAGCAGACTTGGAAGAGTATATATGGGAAAATAGCTCATCAGAAAAAAATATCCTGAAAACACTTCTGCAAATTAAAGCCGCTGAGAAAAATCTGGAAGTAAATAAGGAAGAGCTCCTTGGTACTAAAGAAGTTGAAGATTACAAAAAGTCTGTTGTTAGGCTTAAGAATGAGGGGGACAATGAAAATACCCTTTCTCACTACAAAGAATCAGTGAAGAGACTATTAAATCTGACATGAATTATGTAGAAAAATCTGCTTGCTCTATTAATTTTATGATCTATATGTGATTGTTGTCTAATTCAATATAAAGTTGAAAATGTTAAAAAAAATTGTTTTACTTCAGAGTTAAAATTATTTCATACTAATGCACAGAGGCAATGATTATTCACACATTTTCTTATTTATACACTGGGGTGATTAGACAGTTGGATCTCTGTTTTCTTCTGGTTCTAAAGTGTTTTGATTTTATTCCTACCATAACAACTTTAGTATTATAATACATACATATTATAAATTATTCATGTAGTTATTTTGTCACCTGCTACATTTGTTTCCTTATAAATTAGCACTTACTGGTTACTTTTGAATTATGATTTCTGTCATTTGGGACGCGAGGCCTAGAACACAGTCCCTGTTCAGTGTACATAGCTGCTGTCTATCCAGTGCATTTTTGCAGATG