Transcript asmbl_18394

Sequence
Transcript Sequence for observation asmbl_18394 of TGE0032314:
GCCAGGCTTCTTCACCTCGGGTTTGTTTCCTCTTCCGGCCCTCAGCTCTGCCACACTTAGGCATCCTACATCAATCAGGAAGCTGCTGTCCAGCCATGGAGGGAGAGGAGAAGCCAGCTCAAGAGGCTGACGTGGAACCTGTGGTAACAGCAGGCACCTCAGAAGCAGTGCCAAGGGTGCTTGCTGGAGACCCTCAGAACATCTCTGATGTGGATGCCTTCAACTTGCTCCTGGAGATGAAACTGAAACGACGGCGTGAACGCCCCAACCTTCCACGTACAGTGACCCAGCTAGTGGCCGAGGATGGGAGCAGGGTGTATGTGGTGGGCACTGCTCACTTCAGTGATGATAGCAAGAGAGATGTAGTAAAGACTATCCGGGAGGTGCAACCGGATGTGGTCGTGGTGGAGCTCTGTCAGTACCGGGTGTCCATGCTCAAGATGGACGAGAGGACGCTGCTGCGAGAGGCCAAGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCTGTCAGGCAGAATGGGCTTATGTCTGGACTCATGCAGATGTTGCTGCTGAAGGTGTCTGCTCACATCACTGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAAGAGGCCAGCAAGGTACCATTCTGCAAATTCCACCTGGGTGACCGACCAATCCCAGTCACCTTTAAGAGGGCCATTGCTGCACTCTCCTTCTGGCAGAAAGTCAAGCTGGCCTGGGGCCTGTGCTTCCTGTCAGACCCAATCAGCAAAGACGACGTGGAGCGCTGCAAACAGAAGGACCTGTTGGAGCAGATGATGGCCGAGATGATTGGGGAGTTTCCTGACCTGCATCGCACCATTGTCTCAGAGCGTGACGTCTATCTGACCTATATGCTGCGGCAGGCCGCACGGCGCCTTGAGCTTCCCCGCGCCTCTGATGCTGAGCCCAGGAAGTGTGTCCCGTCTGTGGTTGTGGGCGTCGTTGGCATGGGGCATGTGCCTGGCATTGAGAAGAACTGGAGTACCGACCTCAACATCCAGGAGATCATGACAGTCCCCCCACCGTCCATCTCAGGCAGAGTGTCCCGGGTGGCTGTGAAGGCGGCCTTCTTTGGTCTCCTGGGCTATAGCCTGTACTGGATGGGCCGTCGGACCCTGAACCTGGTCCTGTCACTGCCTGCTGCACAGTTCTGCCTCCAGAGGGTGAGCGAAGCCCGGCCAGGCCGGTAGGAGGACCGTGCAAGGAAGAGACTGCACCTGGGGGCTCTGCTCTGCGCCGAGTGGGGTGCTCACGAGGAGCTGGCGCCGCCCGTCTGGGGATGTCCCTGGGGACAGATGCATCCAAGCCACCCCCTATGGGGGCCTAGGCCAGGCTTTCCCTGCCTTCCCAATGCCCAGCCCACCCAAATAAAGAATATTTAACTGTCTGAGCCCAGGCTTCCCAGCAGCCCACACACACACTGTGGGGCCACCTATGGGCATCAGGGCCAACCGCAGTGTCAGGACCCAGCGGCCTAGTTCCAAAAGGACCAGAAACTGAGGGGGAGGCACTGAGACACCCCACCCTTAACCCCAGGTGGGTTTGGCAAGCTGTTGCTCTACCTACCTCACTGTGCCTTGTGCTCTGGCCGGCAGGAGCATCTGGGCCTGAGTGCATCTCACTGTGGGTTTGGGGCTGAGTGGCCATGCACCTCCCTCCTGGGTGTGTGGGGCCTGGCCTGGCCTGGACATGCATGTGGCATTGCCAGCTGCATCTCTGCCTGCAGAGAGTCTGGTTTTGTGGGGTTTTGTTTTCTGTTTTTGTTTTTGTTTTTTAATGTCAAAAAGTTTTTTACTCAGGTAATTTTGACGTCAAAGAGAAAACAAACTGAAGCAAATATCAGGAAATACAAGCCTTAAATCCAGTGAGGACAAAGAAGTCATCTTTTTATTTGTGTTTGTGTGCCCTGAGTGGGCAGTGTGTGTCAGAGTCGGCTTGGGGGTCCAGGCCAGCCCCTGCTAGACACCACTACAGCTCAGAGTGGCGTGGGGCTGCCTCAGATATGAGCCTGCAAGGCTGCCCTTGGTGTTGGTAGGACCTTAGCCTGATTGCTGTGCATTAGGTGAGAGGCCCAAACTGCACTGAGGGCAGTAGGCACCCACTATGGGCCACGGCTGGTTTGTGTGCAGCCAGCCATTCATGTGTACAGGCTGTGGCTCCTAGTATATGGCACAGCCTGGCAAGACCTAGACCACATTGATTGTCCTTGTGTTGGCTGCCAAATCAGGTGAGACACGGAGCTGGGTGGGGACACAGGGCTGGCTGGCTGTGTACTCTGTCTCACACTTGTGGACTCATTCCCTAGAAAGAAATAAATTTTAATTTTGGAA