Transcript asmbl_18286

Sequence
Transcript Sequence for observation asmbl_18286 of TGE0032301:
CTGACATGCAATTGGCTGAACTCCCGGGGAGGGGCGGGACTCACCGGGTCTGATCCAGTTAAAAAGGTCGGAGCGGGCCTGGGGCCCGTCTCTCGGGTGGAGTCTTCTGACTGCTGGTGGAGCAGGTCTCAGGAATCTCTTCGCTTCAGCTTCAATCATGGCCTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGGGAATGTCTCAAAGTTCGGGGAGAGGTGGCCTCGGACGCCAAGAGCTTTGTGCTGAACCTGGGAAAAGACAGCAACAACCTGTGCCTACACTTCAATCCTCGCTTCAATGCCCATGGAGACGCCAACACCATTGTGTGTAACACCAAGGAAGATGGGACCTGGGGAACCGAACACCGGGAACCTGCCTTCCCCTTCCAGCCCGGGAGCATCACAGAGGTGTGCATCACCTTTGACCAGGCTGACCTGACCATCAAGCTGCCAGACGGACATGAATTCAAGTTCCCCAACCGCCTCAACATGGAGGCCATCAACTACATGGCGGCGGATGGAGACTTCAAGATTAAGTGCGTGGCCTTTGAGTGAAGCCAGCCAGCCTGTAGCCCTCAATAAAGGCAGCTGCCTCTGCTCCCCATAATCCAGCCCTTTCATGGGAGAGTGTTTGTGTGTGTCTATGTGAGGGGCCCCGCCCAACCTGGTCCATCTTCACTTCCATTCATGCCTCCATGTGTTCTTGGTCTCAGTGACCTCTCTTGTGCTTTCCAGGCCAAAGAGAGCCCAGCACAGAGAGGGCTTAAGTGACCACAGAGGGTGAGCCAGTGTCCCACTGTGACAGGGACAGAGCAGTGGGAGGTGGATGGATGAACAGCCGGACCGCATTTGTCTTAATAAAAGCCAG