Transcript asmbl_18100

Sequence
Transcript Sequence for observation asmbl_18100 of TGE0032291:
GCCGGAGCCGCCATTGTTCCGCCGGGGGAGGACAGCGGGTCCTGGCGCTGGCGCCCCGACGCCGCTTAGCGGCCGCCTCTGGAGACACTCTGTCCCCGCCGCCCCGTGTCCTCCTGGTGGCGGCGGCGTGAGGCCGGCTGCGGAGACTGGGAACCTTTGGCTCTCCCCGTGGCGGCGGCGGCCCTCTATCCCCTACTCCGGCGTGAGGGTTGGCCGCGATGCGCTCGGCCTGAGGTGTCGCGGCCCTGTCGCCTCCCACGACTGTTCCAGCGGCGGCTCCGCTCCCCGGCGTCATCCCGCGAGTCTCTCTGACGGGAGGGAAGATGGCTGCACGAAGCTGGCAGGACGAGCTGGCCCAGCAGGCCGAGGAGGGCTCTGCCCGGCTGCGGGAGTTGCTCTCGGTCGGCCTAGGTTTTCTGCGCACGGAGTTGGGCCTCGACCTGGGGCTAGAGCCGAAGCGGTACCCGGGCTGGGTGATCCTGGTGGGCACCGGCGCTCTCGGGCTGCTCCTGCTCTTCCTTCTAGGTTACGGCTGGGCCGCGGCTTGCGCCGGCGCCCGCAAGAAGCGAAGGAGCCCGCCCCGCAAACGGGAGGAGGCGGCCCCGCCGACTCCGGCCCCCGACGACCTAGCCCAGCTGAAGAATCTCAGAAGCGAGGAGCAAAAGAAGAAGAACCGGAAGAAGCTTCCTGAAAAGCCCAAACCAAATGGACGGACTGTTGAAGTACCCGAGGATGAAGTTGTTAGAAATCCCCGAAGTATAACTGCAAAACAAGCACCAGAGACAGACAAGAAAAATGAAAAGTCAAAGAAAAATAAGAAGAAATCAAAGTCAGATGCTAAAGCAGTGCAAAACAGTTCACGCCATGATGGAAAGGAAGTTGATGAAGGAGCCTGGGAAACTAAAATTAGTCACAGAGAGAAACGACAACAGCGTAAACGTGATAAAGTGCTGACTGATTCTGGTTCATTGGATTCAACTATCCCTGGGATAGAAAATATCATCACAGTTACCACCGAGCAACTTACAACTGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAGTCTGGAAAAGGAGATTCTACACTGCAGGGTGAGAGAAATTACATGACACTTAACCTGAAGGCCAATCAAAATAGAAACTTTACTACATG