Transcript asmbl_17700

Sequence
Transcript Sequence for observation asmbl_17700 of TGE0032245:
GTCTCACAGGAAATTCTCAGCTCCCAGGCATGGGTCCTTGGGCTTCCTGCCTCGCAAGCGCAGCAGCCGGCATCGTGGGAAAGTGAAGAGCTTCCCTAAGGATGACGCTTCCAAGCCCGTTCACCTCACAGCCTTTCTGGGTTACAAGGCTGGCATGACCCACATCGTCCGGGAAGTTGACAGGCCAGGATCTAAGGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAAACTCCCCCAATGGTGGTTGTGGGCATTGTGGGATATGTTGAGACCCCACGAGGCCTCCGGACCTTCAAGACTGTATTTGCTGAGCACATCAGCGATGAGTGTAAAAGGCGCTTCTATAAGAACTGGCACAAGTCTAAGAAGAAGGCTTTCACCAAGTACTGTAAGAAATGGCAGGATGACACAGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGCATGAAGAAGTACTGCCAGGTCATCCGCATCATTGCCCACACTCAGATGCGTCTGCTTCCTCTACGCCAGAAGAAGGCACACTTGATGGAGATCCAGGTGAATGGAGGCACTGTGGCTGAGAAGCTCGACTGGGCCCGAGAGCGGCTGGAGCAGCAGGTTCCTGTGAACCAGGTGTTTGGGCAGGATGAGATGATTGATGTCATTGGCGTGACAAAAGGCAAAGGGTACAAAGGGGTAACCAGTCGTTGGCATACAAAGAAACTGCCCCGAAAGACCCATCGAGGTTTGCGCAAAGTTGCCTGTATTGGAGCCTGGCACCCTGCCCGTGTTGCCTTCTCTGTGGCTCGAGCTGGGCAGAAAGGCTACCATCACCGAACAGAGATTAACAAGAAGATTTACAAGATTGGTCAAGGCTACCTCATCAAGGATGGCAAACTGATCAAGAACAATGCATCTACTGACTATGACTTGTCTGACAAGAGCATCAACCCACTGGTGAGTGCTGGGGGCTGAGCCTTAGGATATATCTGGGACAGGACCTGCCATGCGTGCCTCTG