Transcript asmbl_18056

Sequence
Transcript Sequence for observation asmbl_18056 of TGE0000484:
GAGACTCAGCCAGAGGAGTACGGATTAAGTGGCCGAAGAAAGAGGAGTGAGGCAGGGGAGCGAGGCGGACGCTCCGAGCGCATCGGACTCACCTGGGCCGGCGGCGACCGGCGAGTACGAGTGGACTCTTGCCCTCCGCAGCATGCGCCCCGCCTGCTAAGTCGCCGCCGTCTCGCCCTCACCTAGCACCGCCAATCCCGCCTGGATGGAGTCCCCTCTGGGTTCCCATTGGCTCCTGTGAGTGCTTGGGTGTCGGGAGCCTGTTTTTGGCGAGGGGAACCAACTTTTGAAGTTCGCCCAGAAGACTGCGTTCCAGCCCCAGTTCCCCGGCAGCGGGACCCGGCGAAGACGCGACCGCGGCGCGAGTCACCATGGGAAGCAAAGGTGTCTACCAGTACCACTGGCAAAGCCACAATGTCAAGCACAGTGGTGTGGACGACATGGTGCTACTGTCCAAGATCACAGAGAACTCCATCGTGGAGAATCTGAAGAAGAGATACATGGATGACTACATTTTTACATATATAGGATCTGTATTAATCTCAGTCAACCCTTTCAAGCAGATGCCATATTTTGGGGAAAAGGAAATTGAAATGTACCAAGGAGCGGCACAGTATGAAAACCCACCACATATCTATGCCCTTGCAGATAATATGTACAGAAACATGATCATTGACAGAGAGAACCAGTGCGTCATTATCAGTGGTGAAAGTGGTGCTGGAAAAACAGTGGCTGCCAAATATATCATGAGCTACATCTCCAGAGTGTCTGGAGGAGGGACCAAAGTCCAGCACGTGAAGGACATTATCCTGCAGTCCAACCCGCTGCTGGAGGCCTTCGGGAACGCCAAG