Transcript asmbl_17683

Sequence
Transcript Sequence for observation asmbl_17683 of TGE0032237:
GGGAAGGAAGGGAGACGCCTCAACCGTGGCACCGCCCGGTTTGAGCGGGACCAGACCTCCCGACTGTCCTAACAACCCCGATTCTCTGAGTTGTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGACAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCGCCATCGGTCATCACTAGACCCGAGCCGCAGGCCCTCCCGAGCTCGGTCATCCGTGCCCCGCTCCCAGATCTTTATCCGTTTGGGACCATGCGTGGAGGCGGCTTTGGGGATCGGGATCGTGACAGGGACCGTGGAGGGTTTGGAGCAAGAGGTGGTAGTGGGCTTCCCCCTAAGAAGTTTGGTAATCCTGGGGAGCGGTTACGAAAAAAGAAGTGGGATTTGAGTGAACTCCCTAAATTTGAGAAGAATTTTTATGTTGAGCATCCAGAAGTAGCAAGACTGACTCCGTATGAGGTTGATGAGCTACGGCGTAAGAAAGAGATTACAGTGAGAGGGGGAGATGTTTGTCCAAAACCTGTCTTTGCCTTCCATCATGCTAACTTTCCACAGTATGTGATGGATGTGCTGATGGATCAGCACTTTACAGAACCCACTCCCATTCAGTGCCAGGGATTTCCTTTGGCTCTTAGTGGCAGGGATATGGTTGGCATTGCACAGACTGGCTCTGGGAAGACATTGGCGTATTTGCTGCCTGCGATTGTTCATATAAACCACCAGCCATACTTGGAAAGAGGAGATGGTCCAATTTGTCTAGTGCTGGCTCCTACCAGAGAGCTTGCGCAGCAGGTGCAGCAGGTGGCTGACGATTATGGAAAATGCTCCAGGTTGAAGAGTACGTGCATTTACGGAGGTGCTCCTAAAGGTCCCCAAATTCGAGACTTGGAAAGAGGTGTTGAGATTTGCATAGCCACTCCTGGGCGCCTAATAGATTTCCTGGAGTCAGGAAAGACAAACCTTCGCCGATGTACTTACCTTGTGTTGGATGAGGCTGACCGGATGCTTGATATGGGCTTTGAGCCCCAGATCCGTAAAATTGTTGATCAAATCAGGCCTGACCGGCAGACACTGATGTGGAGTGCAACCTGGCCGAAGGAAGTGAGGCAGCTTGCAGAGGATTTCCTGCGGGACTACACCCAGATCAATGTGGGCAATCTGGAGCTGAGTGCCAACCACAACATCCTACAGATTGTAGATGTCTGTATGGAGAGTGAAAAAGACCACAAATTGATCCAGCTGATGGAGGAAATCATGGCGGAAAAGGAAAATAAGACTATAATATTTGTGGAGACAAAGAGGCGCTGTGATGACCTCACACGAAGAATGCGCAGAGATGGTTGGCCTGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGATCTGGAAAGGCTCCTATCCTCATTGCCACGGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTCATCAACTACGATTATCCAAACAGCTCAGAGGATTATGTTCACCGTATTGGCCGAACGGCCCGCAGCACCAACAAGGGCACTGCCTATACTTTCTTTACCCCGGGCAACCTGAAGCAGGCTAGAGAGCTGATCAAAGTATTGGAAGAGGCCAATCAAGCCATCAATCCAAAATTGATGCAGCTTGTGGACCACAGAGGTGGCGGCGGAGGAGGGGGAGGCCGCTCACGATACCGGACTACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGACGAGTGTGACCGGAGGCTTCGAGGGGTCAAGGATGGTGGCCGGAGAGATTCTACAAGCTACAGGGATCGTAGTGAAACCGATAGAGCCAGTTATGCTAATGGCAGTGGCTATGGAAGCCCAAATTCTGCCTTTGGGGCACAAGCAGGCCAATACACCTATGCTCAAGGCACCTATGGGGCAGCTGCCTATGGCACCAGTGGCTACACGGCGCAGGAGTATGCTGCTGGCACTTACGGGGCGAGCAGCACTGCCTCAGCAGGGAGGAGCTCTCAGAGCTCCAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAGCCACAGCCACTGATGTCACAGCAGTTTGCACAGCCTCCAGGAGCTACCAATATGATAGGCTACATGGGGCAGACTGCTTACCAGTACCCTCCCCCTCCCCCTCCCCCTCCTCCATCTCGCAAATGAAACTGCATGGCAGGAGTGACTCGTGCAGATGAATTACACATCTAAAGGAACACTGTCTTTTACCCTTCTAGACCTTTTCATTTTTATTTTTTCTTTTCTCAACCATTACGGTTTATCTTTTTTTAATGCAGATAGTTAAAATTTCACTGCCAGGTTTCTTCTGCCCACCCAAAAGATCCAGTCTATAATTACAGATTTTGTAAGAAAAAATATATATACACATAACTGACTGGAAAGAATTAATTTCTTTCCCCCAGCTTAATGCATGTTGAGGATATTGAGCTATTTTTCATCTTAAAGGTATTAGGCACTTTTGTTGGAGCCTGTTTATCCATGGGAGGGTGGG