Transcript asmbl_17426

Sequence
Transcript Sequence for observation asmbl_17426 of TGE0032195:
CCGGCGGTTAGTGCTGAGAGTGCGGAGTGTGTGCTCCGGGCTCGGAACACACATTTATTATTAAAAAATCCAAAAAAAATCTAAAAAATCCTTTGAAAAAACCCAAAAAAAATTTACAAAAAAATCCGCGTCTCCCCCGCCGGAGACTTTTATTTTTTTTCTTCCTCTTTTATAAAATAACCCGGTGAAGCAGCCGAGACCGACCCGCCCGCCCGCGGCCCCGCAGCTCCAAGCAGGAACCCAGAGACCGAGGCCTTCCTGCCGCCCGGACCCAGCACCGCCAGCCTCGCTCCCCCGGTTCCACGGCCGTTGAGTACGCGTCGATTCCGGTTGAATTTTGTCCCTCTGCGCTCGCCCCCGCTCCCCTCCCCCCGGCTCCGTCCCCCGGCCCCGCACTCGCTCTCCTCCTCTCACGGGAAAGGTCGCGGCCTGCGGCCCCGCGGGCAGCCGTGCCGAGATGAACCCCAGCGCCCCCAGCTACCCCATGGCCTCTCTGTACGTGGGGGACCTGCACCCCGACGTGACCGAGGCGATGCTCTACGAGAAGTTCAGCCCGGCCGGGCCCATCCTCTCCATCCGGGTCTGCAGGGACATGATCACCCGCCGCTCCTTGGGCTACGCGTACGTGAACTTCCAGCAGCCGGCGGACGCGGAACGTGCTTTGGACACCATGAATTTTGATGTTATAAAGGGCAAGCCAGTACGCATCATGTGGTCTCAGCGTGATCCATCACTTCGCAAAAGTGGAGTAGGCAACATATTCATTAAAAATTTGGACAAATCCATCGACAATAAAGCACTATATGATACGTTTTCTGCGTTTGGTAACATCCTTTCATGTAAGGTGGTTTGTGATGAAAATGGCTCCAAGGGCTATGGATTTGTACACTTTGAAACACAGGAAGCAGCTGAAAGAGCTATTGAAAAAATGAATGGGATGCTTCTAAATGATCGTAAAGTGTTTGTTGGACGATTTAAATCTCGGAAGGAACGAGAAGCAGAGCTTGGAGCCAGGGCAAAGGAGTTCACCAATGTTTACATCAAGAACTTTGGAGAAGACATGGATGATGAGCGCCTTAAGGAACTCTTTGGCAAGTTTGGGCCTGCCTTAAGTGTGAAAGTAATGACAGATGAAAGTGGAAAATCCAAAGGATTTGGATTTGTAAGCTTTGAAAGGCATGAAGATGCGCAGAAAGCTGTGGATGAGATGAATGGGAAGGAGCTCAATGGAAAACAGATTTATGTTGGACGAGCTCAGAAAAAAGTGGAACGGCAGACGGAACTTAAGCGCAAATTTGAGCAGATGAAGCAAGATAGGATCACCAGATATCAGGGTGTGAACCTTTATGTGAAAAATCTTGATGACGGGATTGATGATGAGCGTCTCCGGAAGGAGTTTTCTCCGTTTGGTACAATCACCAGTGCAAAAGTAATGATGGAGGGTGGGCGCAGCAAAGGGTTTGGTTTTGTATGTTTCTCATCCCCTGAAGAAGCCACTAAAGCAGTTACAGAGATGAATGGTAGAATTGTGGCCACGAAGCCACTGTATGTAGCTTTAGCTCAGCGCAAAGAAGAGCGCCAGGCTCACCTCACTAACCAGTATATGCAGAGGATGGCAAGTGTACGAGCTGTGCCCAACCCCGTGATCAACCCCTACCAGCCAGCACCTCCTTCAGGTTACTTCATGGCAGCTATCCCACAGACTCAGAACCGTGCTGCATACTATCCTCCTAGCCAAATTGCTCAACTAAGACCAAGTCCTCGCTGGACTGCTCAGGGTGCCAGACCTCATCCATTCCAGAATATGCCCGGTGCTATCCGCCCAGCTGCTCCTAGACCACCATTTAGTACGATGAGACCAGCTTCCTCACAGGTTCCACGAGTCATGTCAACACAGCGTGTTGCTAACACATCAACACAGACAATGGGTCCACGTCCTGCAGCTGCTGCTGCTGCAGCCACTCCTGCTGTCCGCACCGTTCCCCAGTATAAATATGCTGCGGGAGTCCGCAATCCCCAGCAACATCTTAATGCACAGCCACAAGTTACCATGCAACAGCCTGCTGTTCATGTGCAAGGTCAAGAACCTTTAACTGCTTCCATGTTGGCATCTGCGCCCCCGCAAGAGCAGAAGCAAATGTTGGGTGAACGGCTGTTTCCTCTTATCCAAGCCATGCACCCTTCTCTTGCTGGTAAAATCACTGGCATGCTGTTGG