Transcript asmbl_17411

Sequence
Transcript Sequence for observation asmbl_17411 of TGE0032192:
CCTCTCGCGAGAGGGAGGTGCGGTGTGTCTCTCTTCCCGAGTGGTCCCCGCTGGTTACTGGAGGAGCGCTCGTTCTAGTTCGTCCACCATGGCGTCCGTGGGGACCCTCGCCTTCGATGAGTATGGGCGCCCCTTTCTCATTATCAAGGACCAAGATCGCAAGTCCCGTCTCATGGGGCTTGAGGCCCTCAAGTCTCACATCATGGCTGCCAAAGCTGTAGCAAACACAATGCGGACGTCACTGGGACCAAACGGGCTGGACAAGATGATGGTTGATAAGGATGGCGATGTGACTATAACAAACGATGGTGCCACCATTCTAAGCATGATGGATGTCGATCATCAGATTGCCAAGCTGATGGTTGAACTGTCCAAATCCCAGGATGATGAAATTGGAGATGGGACCACAGGAGTGGTTGTCTTGGCTGGGGCCTTGTTGGAAGAAGCTGAACAGCTGCTGGACCGAGGCATCCACCCAATCAGAATTGCTGATGGCTACGAGCAGGCTGCCCGAATTGCAATACAACACCTGGACAAGATCAGCGATAAAGTGCTTGTCGACATAAACAACCCTGAACCTCTGATTCAGACTGCAAAAACCACGCTGGGCTCCAAAGTGATTAACAGCTGTCACCGACAGATGGCTGAGATCGCCGTGAATGCCGTCCTCACGGTGGCAGATATGGAGCGGAGAGATGTTGACTTTGAGCTCATTAAAGTGGAAGGCAAAGTAGGTGGGCGGCTGGAAGACACCAAGCTCATAAAGGGTGTGATCGTTGACAAGGACTTCAGCCACCCACAGATGCCGAAAAAAGTGGTAGATGCTAAGATTGCGATTCTCACGTGTCCATTTGAGCCACCTAAACCTAAGACAAAGCACAAGCTGGATGTCATGTCTGTGGAGGACTACAAAGCCCTGCAGAAGTACGAAAAGGAGAAGTTTGAAGAGATGATTAAGCAGATTAAAGAAACTGGTGCTAACCTAGCTATTTGCCAGTGGGGCTTTGACGATGAAGCCAATCACTTACTTCTTCAGAACGGCCTACCTGCAGTCCGCTGGGTAGGGGGACCTGAGATTGAGCTGATCGCCATTGCAACAGGAGGACGGATTGTCCCACGGTTCTCAGAGCTCACCTCTGAGAAGCTGGGCTTTGCTGGTGTGGTGCAGGAGATCTCCTTTGGCACTACAAAAGACAAAATGCTGGTTATCGAGAAGTGTAAGAACTCTAGAGCTGTGACCATTTTCATCAGAGGAGGAAACAAGATGATCATAGAAGAAGCAAAACGATCTCTCCATGATGCCCTGTGTGTCATCCGGAACCTCATCCGTGACAACCGTGTTGTGTATGGAGGAGGGGCAGCCGAAATATCCTGCGCCCTGGCAGTCAGCCAAGAGGCAGACAAGTGCCCAACTTTGGAACAGTATGCCATGAGAGCTTTTGCAGATGCCTTGGAGGTCATCCCCATGGCCCTTTCAGAAAATAGTGGCATGAATCCCATTCAGACCATGACTGAAGTTCGAGCCAGACAGGTGAAGGAGTCTAACCCTGCCCTGGGGATTGACTGTTTGCACAAGGGCAGTAACGATATGCAGTATCAGCATGTCATAGAAACCTTGATTGGCAAAAAGCAGCAGATCTCTCTTGCCACCCAGATGGTTAGGATGATTCTGAAGATTGATGACATCCGTAAGCCTGGAGAATCTGAAGAATAAACTGTACCATTTACCACTGTGACTAAATAAAGGGTGTGTCTGTTGTGCTGCGTCTGCAGTTACTGCTGGTCCTCTCACAGCTGTAGATGCTGGAATAAAAGCAGCTGTCTGGTAACTGCTTCCACTTA