Transcript asmbl_17392

Sequence
Transcript Sequence for observation asmbl_17392 of TGE0032183:
AGCCGAGCAGGAAGCGAGCCCGGCAGCCGCACTTTCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGGTATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAAGTTTCGGAAGAGCGATACAAACGAGTGGAACAAGAATGATGACCGTCTGCTGCAGGCTGTGGAGAACGGAGATGCTGAGAAGGTGGCCTCACTGCTGGGCAAGAAAGGGGCCAGCGCCACGAAGCATGACAGCGAGGGCAAGACCGCTTTCCACCTTGCCGCTGCGAAGGGACACGTGGAATGCCTCAAGGTCATGGTGACACACGGTGTGGATGTGACTGCCCAAGATTCTTCCGGTCACAGTGCTTTGCATGTCGCAGCCAAGAATGGCCACCCAGAGTGCATCAGGAAGCTTCTTCAGTACAAGAGCCCAGCGGAGAACATTGACAACTCGGGGAAAACAGCTTTGCATTATGCAGCGGCACAGGGATGCCTTCAGGCTGTACAGCTCCTCTGCGAACACAAGAGCCCCATAAACCTTAAAGACTTGGATGGGAACATCCCCCTGCTTGTTGCAGTCCAGAACGGCCACAGTGAGGCCTGCCACTTTCTCCTGGATCACGGCGCAGATGTCAATTCCAGAGACAAAAATGGAAGAACTGCTCTCATGCTGGCTTGTGAAACCGGCAGCTCGAACACTGTGGACGCCTTAATTAAAAAGGGAGCGGACCTGAGCCTTGTCGATTCTCTCGGACACAATGCCTTACATTATTCCAAACTCTCGGAAAATGCAGGAATTCAAAACCTTCTATTATCAAAAATCTCTCAGGATGCTGATTTAAAGACTCCAACAAAACCAAAGCAGGCTGAGATCAGCTCCATACAAGAAAACAAAGACAGGCTGAGCGACAGTACTGCAGGTGCTGACAGCTTGTTGGATATAAGTTCTGAAGCTGACCAACAAGATCTTCTTGTCCTGTTGCAAGCAAAAGTCGCTTCCCTTACCTTACACAATAAGGAGTTACAAGATAAATTGCAGGCCAAATCGCCCAAGGACAAGGAAGCGGAAGCCGACCTAAGCTTTCAGTCTTTCCATTCGACCCAGACTGACCTGGCCCCATCCCCGGGCAAAGCTAGTGACATCCCTTCCTCCGATGCCAAATCATCCCCACCCGTTGAGCATCCGGCGGGGACGTCCACCACTGACAATGATGTCATAATCCGGCAGCTCCAAGATTCCCTGCATGATCTGCAGAAGAGATTGGAGAGCTCCGAAGCAGAGAAGAAACAGCTCCAGGACGAACTCCAGTCACAAAGGACAGACACGCTTTGCTTGAACAACACAGAGATCTCCGAGAATGGCTCTGACCTCAGTCAGAAGCTCAAGGAAACCCAGAGCAAGTACGAAGAGGCCATGAAAGAAGTCCTGAGCGTGCAGAAACAGATGAAGCTGGGTCTCCTCTCCCAGGAGAGCGCCGATGGCTACTCGCATCTCCGGGAGGCGCCAGCTGACGAAGACATCGACACACTAAAGCAAGACCTGCAGAAAGCGGTGGAAGAAAGTGCAAGGAACAAGGAGCGGGTGCGGGAGTTAGAGACTAAGCTTGCGGAGAAGGAGCAGGCCGAAGCGACTAAGCCACCTGCCGAGGCGTGTGAGGAGCTGAGAAGTTCCTACTGCTCTGTTATCGAGAATATGAATAAGGAGAAGGCATTTTTGTTTGAGAAATATCAACAGGCCCAAGAAGAGATCATGAAACTGAAGGACACGCTAAAAAGTCAGATGCCACAGGAAGCCCCCGACGACTCTGGGGATATGAAAGAGGCCATGAACAGGATGATTGATGAACTCAATAAACAGGTGAGCGAGCTGTCACAGCTGTACCGAGAAGCCCAGGCAGAGCTGGAGGATTACAGGAAGAGGAAATCTCTGGAAGATGCAGCCGAGTACATTCACAAAGCTGAACACGAGAGGCTGATGCACGTGTCAAACCTGTCCAGGGCCAAGTCGGAAGAAGCGCTGTCGGAGATGAAGTCTCAGTATTCCAAAGTGTTGAACGAGTTGACTCAGCTCAAACAGCTGGTGGATGCACACAAAGAGAACTCCGTGTCCATCACAGAGCATTTGCAAGTGATAACCACGCTGCGGACAACGGCCAAAGAGATGGAAGAAAAGATAAGCGCCCTCACAGGGCACCTTGCAAACAAGGAAGCGGAAGTGGCAAAGCTGGAGAAGCAGCTCGCCGAAGAGAAGGCTGCCGTGAGCGACGCGATGGTCCCCAAGTCTTCCTACGAGAAGCTCCAGGCCTCCTTGGAGAGCGAAGTCAATGCCTTAGCAACAAAGTTAAAGGAGTCAGTAAGAGAGAGAGAGAAAGCCCATTCCGAGGTGGCCCAGGTTCGAAGTGAGGTCTCACAGGCGAGAAGGGAAAAGGACAACATCCAGACTCTCTTGAAAGCCAAAGAGCAGGAAGTAACTGCGCTTGTGCAGAAGTTCCAGCGAGCTCAGGAAGAACTGGCTGGGATGCGAAGATGCTCTGAGACCTCGTCGAAGCTGGAGGAGGATAAAGATGAAAAGATAAATGAAATGACCAGGGAAGTCCTGAAGCTGAAGGAGGCCCTGAACAGCCTCTCGCAGCTCTCCTACTCCACAAGTTCATCCAAGAGGCAGAGCCAGCAACTGGACCTGCTACAGCAGCAGGTCAAGCAGCTGCAGAACCAGCTGGCTGAATGTAAGAAACACCACCAGGAGGTCATCTCAGTTTACAGAATGCATCTTCTATATGCCGTTCAGGGCCAAATGGATGAAGATGTCCAGAAGGTCTTGAAGCAGATCCTCACCATGTGTAAAAACCAGTCTCAGAAGAAGTAAAAATGGATTCTTTGGCAGGACACTTGCCCCTCGTTGCCTCTCTTTGTGTTAGATCTGGGGTTGTCACTGACCACTGCCATTGTTCTTATCCATAGTGTGCACTGTGACCCATCGTAGCATCTTTTCCAGAGGTTTCTGAGGGCTAGTCCCAAGAGAAGATACCCTCTTCAGAACTGCATAGGTACTCCAGACCAGCAGAGGTGAAAGACCCTGCTATCTCTTCAGAATCTAGCACTGGGATTGGCACCATCCCGGTGGCTTTATGGAGTGATGTGCTGAAGCCACCATGCAGTGAGTGGTCCTTGATCCCTGCCTTTGGGATGTGCCATTCAGCACAGGAGAGCATTTTGCCTTCCATTCCCCAAATATGATTTAATTCCTAACCAAACTAAAATGACACTAGAAGTGAATGCTTAAGACCCTTTCTCCTGTGGATTTAAAAACTCTACTCTGTCCCCCCAGCTGCCTTAAATCTCATCCCCTTGCTTGTGGTCTCATCATTTGATGAGTATCATTAACTAAAGTACAACGTTTTAAGCCAAGAGTGAAGTCTCCTTAAAAGTTTTCAGTAAGTCAACATACTGTAAATTTTCTATGCAAACTTGCCTAGAAAACTTTCCACAATGCTCAGGAAGTCCAGATATTTGTATTTCAACAAAGGACAGTAAACTATGTGTTTACAGCCAAAAGACATGCCTCATAGTTCTTAACCTCAATTTTTTAAAAGTGTTTTTTTTCCTCTATGATATTTTTATTGGCTTTTAAAGATGTTTTCATAGCTAAAGCCCTAAGTAAGTGAGATTAGATTATATTAACATTATTTTTAGATAAACATACTTAAGACTTCTCAAAAATGTAACTTTTTCCTCAAAAGTTTTCAGAGGGTAGTTATATATTCCAAACTCAGTATGAGCTGCCACCAGAACCACTAGGAATTTCTGTAGTCTACTTCTGAATGCAGTAAATACTCCTTTTGCCCGTTGAACTTGTAAACACCTCAAACTCTAGCACCCACGAATGATTCCTGAAAGGGCTGTCAGTTCCAGTCAGCTTCTCCATGTTGAAAGTAAAAGTTCCAACATGGCACCGCGGTGCATAGCAGAAACCTCGGGGGAAATACGCCTACCGACCTTACTTTCAGGTTGAAAAGGTTCAACTTGCTTGCAGCTTCTCTTACAGCCCCCATGGTGAGGGAGATAAATGAAATAAAGGAACTTTGGGTGTGTTACTAAAGGTAGCGGTCTACTCTGACAGGACCCATCTGAGGCCACGTGGCTGAGTTGGGTCTGTTCATCTGTCTTAGG