Transcript asmbl_16629

Sequence
Transcript Sequence for observation asmbl_16629 of TGE0032167:
CTTGTCCTTGAACTCGGGGCCCACAATACCCATACGAACGGCTTCTTCCACCGTCAGCTTGAGTCCCTTGATGGGGTCAATGACATAGCCGGTGGCTGCCTGTGCTTCCAGGAGCTCAAAGGCTGTCCCGGGGCGGATGATGCCCTTCTTCATAGCCTGGTACACCGAGAGCCGTTCCTTGGTGGCATCAACAAAGACTCCGGCAATGCAGCTGGTACCCTCGAGGAACTTCTGCAGGTTCTTAGTGACCTCCTCGATGGAGGTCAGGCCTTCTTGTAGCTGTAGCGCTGTGGCCTCGTCCATGACTTGAGAGCGTACCAGCTCCTCCACAGTGATCTGCTTGCGGAGACCGCGGAAGGTCAGCTTGCGGGCATCAGAGAGCAGCAGCAGCATCTGGCCGCTGGGGTCATCACGGCGGCAACGCTTGAGCAGCTGTGTGTAGCTGAGCCGCTCATCCGTGGAGGGGTCCACGTAGCTGCGCACCTCGCTGGGCTCCGACAGCTGGTCGTGCGTGTCCTTATTGAGGTAGCCGCGTTGGTAAGCCACCTCCAGAGGGAGGTGGAAACCCAGGCGGGGGTCCACAATGCCTCCTGTGGCTAGCTGCGCATCCAGCAGCCTCAGCGCCTCCTCAGCAGGGATCAGCTCCTTCTTCATGGCCTGGAAGAGTGAGATGGTCTGTTCCGTGTAGGGGTCTCGGTAACCAGTTACAGCTCGCTCGGCAGAGAGGAGGCGGTCATGCAGCTCGGGGCCTACCAGGCCCTTCCGCACAGCCTCATCCACGGTCAGCCGCTCCCCCTTCACTGGGTCCAGCAGGAAGCCCGTGGCTGCCTGTGCTTCCAGCAATAAGCGGGCCACCTCGGCACTCAGCAACCCCTTCTTAAGGGCCTGGTAGATGGTTAGCGTCTGCCTGGAGCCAGGCAGGTAGACACCGGCCACCGCGCCTGTGCCGTAAAGGTAGCGCCAGGCAGATTCCATCTCCAGCACTTCACGGAGGTTCTTGGTGCCTTCCCGGAAGAGGTTGTAGGTCTCAAGGGAGATGATCCGGGCCTCGTACAGGTCTTCGGCAGTGAGGCGGCGGCGCACGTAGTCATAGGAGGCCAGGTTCTGCTGGCGGATGATCTCGGTCTTCTCGATGATTTCGATGATGATAATGATCATGCGTTCCTTGGTTACCCTCCCAGCCTGAAAGTCAGCCATGAGCCGGGCACGCTGATCCTCCGGGATCATGTTTGACTGCATCACCTCCCACAGAGACATGGAGGAGCCACCGTGGCTGCCACCACCCGGGATGTCAATCTGCGTCTCCTCGAACGCCCTCCGAGTCTCCTCCTCAGTATACACCTGTGTGGTTTCTACCACCTCGGTCTTCTCTGCCCCTTTGAGTGGCAGGAGGCGCAGGCCGGTCTCGGGGTCCTCCACACAGCGCTCCAGCAGCTGCAGGTAGGTGAGGTTCTCGTGGGTGTTGGGGTCAAA